AExifMM*bj(1$r2i-'-'Adobe Photoshop CC 2019 (Macintosh)2019:08:26 11:29:52n &.(6HH Adobe_CMAdobed            j"?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?UGuѱԲ^ ){X_`]EvِϰScNl۽ygYGgPʳ(bY宷{o)8ԟa.mu#'A7nuzMj駧\pgЮRmmVoy{)+^ZOP Բ)ܖ\Ƽýw.SޗW"42Ts>d7)ߤn"[Gq?DZk8 ÚW_zV[s:}׵g~5ߤmn vNzmzϵ%>K>s?5=;,ы]~Ʋ{z̳lcv#&?_,»_Da?khmi[lW{Aq\X:kXl3ese6@iXWYowopm" kkDgڽ/S1oyq[okzzv.E88# NeC['*Hb~}R1:hʩ9בZ }q+'쳦Y:9^>1=޿/E/hxo])Щ7˿>(р>>FIK]ӳmϱp="=r?V1.Onupo5 fp:8D6ѻ#^#`}Y!XNT^wD$ H/3m}Q>ל.,w{=˰?P>F F~H踽aBZ7tQmۃ_h)zϮY =r=&Urf߬Xm ?ز*}g2Cg}O|Sӟ36kiX;axzUcq#qϐԒ~4A_E/i99}T9/Q?0?(~/~cU~wJu>['Ml*)1[@$n;usk}ens=%_7-L|YPvCM>E597_@ !sf:!69(ӣM+~/VXB-fEd'pr]z.gT Mـ K f^j@k?T=Vk\zzKU?6{OK-Ҥ4~o̡)X:I'{|ԽlO%Av'SQ6$k⍏Qzokn0UV]Kw2/n^-.w Co"{oۗ_?]?WkZc^Y@{Zua#;?ͷ.AۇZo؍[]ٽUjGn>(|pG AK@t$$~Q]8pa鹞ڄ۱N=y#Iy? ?XqC |=K׫V4ZyjnV;S''af&RFZוb[&{Fv>'v1-=xT[MYzMqʪq5^|`D4YXྃCJ}_+unޥܚX[lE~調`վ^ؒVA'Zc}'/atlr>WΓt7:sKZ,KKq,keF<Vֽo^ }U]Z^}鏤_VQْKޗC?/?"UQuvPZk?lפ$4;?T\] 6 :uOHщi.o[cv9̽ϟUZW5}'7ujBɮ Ɇ^pO,l`7iŁ;;l9~׮ts}~pqk79E+)G5ΰ7(rLN~<ϤW"UyVlmmuK<\}X֩vV 7AD\'6XMtV"̊}wҮggQ[*sEY"KEOIy\zP5~o?N܊,mM}ח2^:4%3%J}a%_Q03Uo;ua%?>jIp.sݡ[.~b1+E`53it\ɜ6ƞ'Ir;meF[50?V> +neÍl snn{*+ EO2̭ޕ/thX̱(?=՚D9 {VMJ Y p'/ŬODs~k ݦ,۾ںm]óZ=DW ϐ*::l m.ɳ# v!leGsMu >bεYuO?c3 npkߌXuZu.5=~+\\I5LgaSc;mVՄՋ.kX+ݻ߹Mw]hsW[?>Y-G+ӗ~'?$>C!=Jhntѯ=NƘ!оfI)~p<]{䀹΁%v_Z҅w}/b{&Kv.}Dx~V&vc@>NcUMg)}lVY͌xV빧lx<e` z_kjO<Ç|Ե *\cߕ$ Z`:?ܻ}~;#}okW)*sFa=Wa%4\ n"`A1D{!Cڊ\և%F{@_(ƺk3\?ۊ5ds c=XEmvK.ˏ߽)p]j5}MmN@5^&÷wZۋIO~z?TĖa']_ퟳi0{%c5n2Ä7v5ݘH9W2LO!}fAV:SXz͘ӏ.t{}Gu`,0DjϱbAO+oeC _k^Y1Yu s>Ocv[kT%1ĀhL-m{uq-K0 lVKo܏paÇ{8i>TRD%}- /fr/6^,mor "YcB?۝;*`#:osx޿c+ |=iq߹ZsU=Io4C }?mt:L{]S12O^?P!$[3@?%4C:@:[t/ռ~sϾCSPhotoshop 3.08BIM8BIM%\/{gdպ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTBrother MFC-9330CDWprintProofSetupObjcInstellen proef proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM Z8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIMU nworkbase_foto-16n nullboundsObjcRct1Top longLeftlongBtomlong RghtlongnslicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong RghtlongnurlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM j@ Adobe_CMAdobed            j"?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?UGuѱԲ^ ){X_`]EvِϰScNl۽ygYGgPʳ(bY宷{o)8ԟa.mu#'A7nuzMj駧\pgЮRmmVoy{)+^ZOP Բ)ܖ\Ƽýw.SޗW"42Ts>d7)ߤn"[Gq?DZk8 ÚW_zV[s:}׵g~5ߤmn vNzmzϵ%>K>s?5=;,ы]~Ʋ{z̳lcv#&?_,»_Da?khmi[lW{Aq\X:kXl3ese6@iXWYowopm" kkDgڽ/S1oyq[okzzv.E88# NeC['*Hb~}R1:hʩ9בZ }q+'쳦Y:9^>1=޿/E/hxo])Щ7˿>(р>>FIK]ӳmϱp="=r?V1.Onupo5 fp:8D6ѻ#^#`}Y!XNT^wD$ H/3m}Q>ל.,w{=˰?P>F F~H踽aBZ7tQmۃ_h)zϮY =r=&Urf߬Xm ?ز*}g2Cg}O|Sӟ36kiX;axzUcq#qϐԒ~4A_E/i99}T9/Q?0?(~/~cU~wJu>['Ml*)1[@$n;usk}ens=%_7-L|YPvCM>E597_@ !sf:!69(ӣM+~/VXB-fEd'pr]z.gT Mـ K f^j@k?T=Vk\zzKU?6{OK-Ҥ4~o̡)X:I'{|ԽlO%Av'SQ6$k⍏Qzokn0UV]Kw2/n^-.w Co"{oۗ_?]?WkZc^Y@{Zua#;?ͷ.AۇZo؍[]ٽUjGn>(|pG AK@t$$~Q]8pa鹞ڄ۱N=y#Iy? ?XqC |=K׫V4ZyjnV;S''af&RFZוb[&{Fv>'v1-=xT[MYzMqʪq5^|`D4YXྃCJ}_+unޥܚX[lE~調`վ^ؒVA'Zc}'/atlr>WΓt7:sKZ,KKq,keF<Vֽo^ }U]Z^}鏤_VQْKޗC?/?"UQuvPZk?lפ$4;?T\] 6 :uOHщi.o[cv9̽ϟUZW5}'7ujBɮ Ɇ^pO,l`7iŁ;;l9~׮ts}~pqk79E+)G5ΰ7(rLN~<ϤW"UyVlmmuK<\}X֩vV 7AD\'6XMtV"̊}wҮggQ[*sEY"KEOIy\zP5~o?N܊,mM}ח2^:4%3%J}a%_Q03Uo;ua%?>jIp.sݡ[.~b1+E`53it\ɜ6ƞ'Ir;meF[50?V> +neÍl snn{*+ EO2̭ޕ/thX̱(?=՚D9 {VMJ Y p'/ŬODs~k ݦ,۾ںm]óZ=DW ϐ*::l m.ɳ# v!leGsMu >bεYuO?c3 npkߌXuZu.5=~+\\I5LgaSc;mVՄՋ.kX+ݻ߹Mw]hsW[?>Y-G+ӗ~'?$>C!=Jhntѯ=NƘ!оfI)~p<]{䀹΁%v_Z҅w}/b{&Kv.}Dx~V&vc@>NcUMg)}lVY͌xV빧lx<e` z_kjO<Ç|Ե *\cߕ$ Z`:?ܻ}~;#}okW)*sFa=Wa%4\ n"`A1D{!Cڊ\և%F{@_(ƺk3\?ۊ5ds c=XEmvK.ˏ߽)p]j5}MmN@5^&÷wZۋIO~z?TĖa']_ퟳi0{%c5n2Ä7v5ݘH9W2LO!}fAV:SXz͘ӏ.t{}Gu`,0DjϱbAO+oeC _k^Y1Yu s>Ocv[kT%1ĀhL-m{uq-K0 lVKo܏paÇ{8i>TRD%}- /fr/6^,mor "YcB?۝;*`#:osx޿c+ |=iq߹ZsU=Io4C }?mt:L{]S12O^?P!$[3@?%4C:@:[t/ռ~sϾCS8BIM!]Adobe PhotoshopAdobe Photoshop CC 20198BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I']eDM$vRIZ*n\lǓW/]n _~If{8ײь?4& :IPX.}j^۱KǑzIQ3柽fx>O^8BwOkp<}o:'VT%9w [@v qs zLLϫY)u]d Vu#V9wcjêp$EcI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$Pt|50Cd{Z$I%u{g%ď% QAb%NާM}૿$3R$Y6 ϊ+Ŧ$XOAYZ:y"K O !r`wzξM}pt8 ;\8?~^Ļ,1//)Iz(ԷD?+̂G#ĝtgYrv^d:u$L?ōG@L=IfلǭVI/5Iz;ŝS"9V-%/abNK7 !%l- 4|^ĝD Xg +n]şޜ9GIgRu.%[5$2)nW*y0UDIHtI$<I$违PI2tJI$I%)$I$IJI$I$%)$I$Jh))I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$bHe-/>AkU;Z'RHJ ϷOG\V"KoNDWQ:< {:i,Gq1wUmnN$KqKD!IE?I$I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$"Y]@ǀ+85^;0m2gl}g52@xUy_T} É['{4$.l#@tBvɔAyM)L#$l0N:PL쬒$WY UCx$j54֗Iw`^'N]$Xֺ&}k:y#rڲp{ #P?D}7 .J"cN[ 3 eiaPyπʹk`6?Wwj ZYE Z򉉢۹$HtI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I#aۙ`8$$BCK!WM{u?SvGcB몥4 9Ne;%au߭4C?_]=~t*3ct=4RvS$dv:֜asKxLs˚>:Rf0ʶZKI.qSԜ] ҲG#U1|8T/f0kZG\O֟ï8s7dkR-ܯEXĮ?8 6Z{+̆GYQ4%}us(LSzE:>}lvkǒ:/]I$(RI$I% )I&I$I%.I$I$$I$I)I$I$JRI$I$I$KGyl$$ʟV دwuQmG2']5 ۵ [k`cj9YlA徽a4KyNKqytGfXusTG#I&Dz ݴLjeMd&thDt M#$F jIg_q\;U~JԨTS#m Gk[JTn68DHjPn>L :$5йi3teFR  @F\U7X+o=!0B}Y7nˠ~r?ypiiʳEf<<4:ϩYelĿHѧ$$KWI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$]OO="U>}]wV9M:[2:;*<5kc; rMXB5 +\ ŖV_ R4ezk#Nxef=V:xsHT}IUUpL*GuOж O^K, ]ȅ&e$|G qPX:o(6U=Z*u~e!V@hq#@uW 䮓'wج^==6=$I9MPwR}:qۺdp@{AMRJJyAKױHe9>~ȢX [u$:w6xI1NJUhQ{ ^7`|Z;OJ BtH%Jtݒ\\I2 :=Hh.N~I')SAvVI j%S 3:ec$IR#E0;jBy:iI$C&w5BC'*$ 4#dd1AǑ(lot¸61#Y,$ƠBų|6Kga&8#)ړA;tꔁiKR2 $i欹s7io vd)$!K>E#ik`lN!y3*|Tو?#sIF'mdyuG5A."R;QC krNOPr[;F1M BHJmh0'zө<(xq$ȡm(Fmxhq-prʯSϸZDk <(HpFw䦨7HG1 *pa WSe7F#FFR Htt`* na\u?5@R-ֽ ;U1xi.GT\ DwRp_*fDCy dN`y9ySoKq%ۉSiFe-;[ @EGdc9~ ;0j7=_5v8,v@ ɓʙ H۲~O/0PM|V=e]{entLԦ rw;%4[_C@)k2c NciVvEg[0:SʒF()%7uL2,kbUdQcn.l=^Ϩhx>j?@ҽϯ} b@s${ %~I,!toQpY.ҲvT`-d$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$~^XE |R Z$XK#KG<^{}%=;Wp:exmkjlC9 6ĬiY;[=7~>m.6;a= ."jJ>ݾiXT<(z5,e84@ihl8Œ ]R,Z a5UuQu)14 m.>)44yAIks>e{]/eNnlәJt?"%H6ZG(ISJg*Y،ͩ+zD)5sgc쥒[]%K RDG7k '3%7 "~߂XmO;{^u6=`:q@8! ;)QY]v3{<,S%yK&yȟ_S , WpϠ3ed?~gTJ%5Et7s%3/5:Z /70Ep._/7ikPG\Զ'G'u븟^qn-c*oe4B+x+k۹qowAǮQ.~i]]>ӭ7;)Е[0 ,e{m#˞lm|WBKzԼ|a8\Sto$ WN.CYh9?k|vbkZ` HЧ-tQPA 2I$I$]gc>\-l685{/@8umh̆ V+=\SS0}WnL ^)êYd Z,@Oa;`Vfqd9ڎ^V68w69^UȬuRBT,Qu0K/vSqO}^QS4G<-~M,0&^35?RLjpЅ86(r~}iEYN$5ڵ* $+Y$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$ҺeJX:OƗ4rW}JΟ^?HTa_,|c\{'+/?(mtNGN0D Uv(qs:ٙ/|x‹+g֙"tprNs^FEkH04jSNavP{'IH9R5<2Ξ'DgPk#F*ZcT$kSu #:IBԱ"qk | .k$I" =Dx(2탙V*kƠI10S<`qxFee8̬}I1=M缑 hB%h YO1e0@gH4Zͨ4DŽ.i:+ kn}5d<)g8j=Y&LA(-dOJRN\5F:F?!6ۣ ޣo[}I'TTN?h$N"{h8ƍn^u RB d {@(~ $vT.S)$I!%'NP e8ǚI)'T$\t'Ԥis 4ǴhYn|9}i.5 -4L(OaSoGt$fY =md{Iy,턗A:IOXu&} Z, n{Sƹy3baD7YR)BDjxmԐ!3T-aU+Z CaWlν#F>#G OXkxO֌X Wh>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I% U\K.23 oڝOeN0AxLyO)S;%,|cYRa֎J`Dv$Z[ 0Yy81Yid7X{=ZӎQΉ*@1wG`ODm0d# S\'HTńZ[aJ_7D89Bu{_DpsMAAnB##S7jAY{PsA >@~)7tEk@pJ;ЍSS&SPt!n$ <:H 0e$a#ژ~12%ܩSRtOȄ(sv=&] lXO Z\؝GdײI(%N;EôSU({%ǚBS5ǺHO(_`<T Z N[YCt:SQQRu] a7R"ѯu5o(V4F*E;4dje}UZF6I \6ռK+uN,x;Y9~+ϭո eښC\_՟ޑ]H"BI$I$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$ #bY`I%-$8? gz|WV lh!bW xmkx txcM|˽6@b$ʵyoKLR%1+Y ꬀ qT^atxn\ϴF=mœP$5M8=ԷBiEΓv>%4np3q5)" Ey48MqI A; ΠvU!dywѡNH5gZ̷^ a1+F:<b5Q6L!M4RP!I)cZ\겶XΚDSk_2ï,:"x>+3=l]ö2re(OhM4y~HkK ;W'ѳw1=KUpk\ũ$I1I@'CF$N$O!)3A62`G)D!Ui|;;JI'Q@ oaz&yJuDv~(4򜄆HY3<+7ҍCLp,5ƃP$\&~d<*$wAYk%ƁGI$ dkN%8\PϫciE۝IRE !EwhNk[/q&U#Tăy $K ýk  $|P'4)'I$0{lП9q;nJILTJdҦN,nɅ{ 67W0UHflDuR;:4z\^xjWAY%_>j:b 29y;IRu:"-wb:HIRt*1ݴ3S)Ήڔ Szrs,qmM HׅnvSE}= zhNL7tCz;<~n7ulʵk%ćqN ENn2&v+I8Po1Qͣ{ R%0NCK'[ PAWm3kaTqtju2Jq%$Ax1ߴ8!=48/08\\_& ŬacO -: ~ vk,=] };IӅnV. V{DIh $I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$PޙwRU@ S(!~| H T/.:ͷ ?[-GqX/'$MU_\;"|Jq4h  =,ɮk:%d Wfu7 \X䝚qԬ_V[fC`!(I^/֟~d۽xF\ZZ sKnJ[I:G5(|6ʃc_ܨSN)ZI? S?h4%Þ<ML Ne$,O> [|S[A09M A?LXm^RΩ>Ił`q!EڎS:Y`Ӥi `#WI~0&8t⑴%Kt\HJo $nSI*?QXK4A" 4EyC P}Å`!8"4;_GkML^Ƈi. L:?8ߗ~xG? U>k HJUceP^{[^rؐz^{ne:xI^-2S->!QSO$tgR.yVI$B$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$]b\x ~G~@w˚EI&5Un S2zXmg^>c*`RV6+igpqܬ|=1܎1KvKk; K>qoLNpO ƽkcG':\x7?DV%I>ݠ4h&xQlI Ufl8+C88JPLNS-NВI$tduD U|g$% 8ASZuMX؟oq""*I~CaH0UuAB;^6$x&u)oT;T[,{^aɔlMA>KjuFhR4۬NGۃL7FƞY$A#_4G:vQ0 )l4;p4NƅfAK?vABrX!4OJMIɞ08.Ԃ^4O$0&/qC44.[O(}ZqS UpLHR)hytg]ܞj&m 9 zϸ%1PSNTvn$$~ٻA"$ gKO8%XLCaϐGw,N;@*e &+c/#_RJJk[wZ,x.+"ڟ 0Ou}47hdD!&i4:2P,HhW^%m}ߚ <(줣\- jcFGX7]{=Ο~R?:PmU!{O^̀v} I$zU#!Vx:'sDז[?ܚ)ٕ>=Pi>4<ʇ|P l$ɾ Ȕ%%{B d|hNK|BaK w_񛃵xB>t_!ZÐ aIrX6:e`hRHZ.I$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRII$$I$I)I$I$JRI$u0KawT>p<&"ʓ9IrZ6q+:|ZUz+n<>=G෶|Ҫ^fy-(9Zz3mY&q,tBjw & y -`\L`1)$2y.PnI)kNS  t#R׃ĔN*aZYɋkpQ,!U{ +V0IT.3+[чIqqߐ֏1<)9S'E 8IL]C\[fA:5J n"O#l)BIX<;mp2G"5S_`WTXRNLgq?z5=K±M gp"6tS"CBNYig > ״'`N;())ar 9D`^L7A*@wQ@k]$.1 K GDBҼ%ݵR|a Z[)  %cΪT#wQSBm֎SHo%}LhS)1[% mJu!:LH4 3ṿ40˓@)NDO?\(G B.'Dʝv$uN4 4 'TG?%o ӅVh<k:]ОxGDn:58%Yjxs@O%i.l[Hf1 mt\QNCXvSBoPS߳,]įL$t]OMp$r$SeֶYÅb ޽%Ku4<8ƣI$I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$H %{l@I,ғ'PJU4f% Hx jhn> %sK,񈈠ʃR6{=0uY2lh V6h#XCVAyTF%CkeՂgID}6wA:~xru`pFߢ JE[O'[ϻT>ZthW*"ЂQ[CQ$|xm)!%*%͒+wD\j >p1omJH$IƢ:4Neގ7"1ӬpT8h$O.A.i"{ ps! i`0O7Ҧ]HН:G(gu@D:n? 4oGE4eDN:JF̧\56lw^h@Pa0:W5hAu^qc~w0&:FПol>Y?gP͏kff y)B.3OrB6;aWtU~gÔN5?l$DeK2p= LM)]m$2GA1.䯳\BtJ[T`Ir;v"vrL%ѯt&"@WW)t̓3ς<I$Ĥ5cK]3pN('lH9Fּ45Ya9M)a4H Ʀ_;=|Ku UGxZV\H$irxDLSAV u>jaCBG&aG. Q'( &׫uOkLwUn]}4M=8УY /F"QEvG(۸ju:|fNLfr^kٴv$M>(UIf8Ȥ$uy,3"g#h;(k$5STlh5q|T>f8u'+s٩$6)-7_k8'-$޹-%ɣħ,á'L5<%$6HI᫜{ :c}:Z`LB[[uY^HpND(ѠKueV.nh hUp~Crmm=N'@ S흎}{+ͱkDưQ_qq[pt?J!(:P)acm?<qmN'Y6e"4):ltI$B;v=B{)ې,ZmmVJip6 /ӕν,p6҄RM塇P\T}Kr8*v@-?褒I% m{ pRV$3%u·xz/'\Xgrҷ4T3\GOxf S⃣c ƫZұpvLFWSS?xMF]Y处5B8ܳF ZHzdJt,s5I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I)USpcZW t.$:;Rb`Jպ}6>Bee1Άq-.<߫L,djWA tncueYa#p=A!G:9I.RB;D @ gS*\R;'LSI'ODΨ`srS5Ĥq#iRƀw64CCa!zNCI"8 T,nE9&B@JE$U ⥼aq%0<)B}mM%*w:SmK #Kݦ`.$|] ft)WIqO[w*Hv4RHJi "9qLB#vm5><;Q[VX|JG7dƲ2Kd;Um<*hoV%@A{%SŤV9<;&)9 -? $ i>"TDiB [(RvN&w"Fx!%,֓DSxhb蟎S WB- moq'* Ή%K'xV(yhG, N^%CAl4#*ǨSMs-n K UZDY:(WIc^NJ1n`p XN[!amUiG_ژf^2~_b&Hq%S&qa"^N\gWp RI$BI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$]ߵWge!,pS#_6rRV,{]CIۯ#"VH2u0cNIiwCݼe^4TgC"3x3ӤidAe#o"5(>}INp d BQ:։{$#m dL! 7j\H|S sYhqP4~wm<5)SĈMΩ䤦#$cL^ZݝBZ ;(Th@6m#Z?5_7njkl :'TFF4{F%:xL mv@F8䨺D-+hkK}(*.))qv+j|G)~"0o29 5{5S4 9_G|6qz7R1[`4EZ]IJd:~hUKQsX"JA$ Z'襕kj{&ǵ4i؏0WK&)dʍ$lYX,|*m :7$tX će#@&$Ht3!!s\۝nݍ0 D)BtTzv{}FxߖsC~#I%$R2L@I|*Y.i[C@[ʙPT6H8M:5*>+UG l { !ߺ@KEQB,s Fltx:uny$o$HJThpF+rAI-[Y- ٬4#se%Q=Rӥ*!8 'J_1š8rr_zvßCltTZt.骆Bk@QOIuкGفN_>߂$ A:H]ü ?+C>(hݣP Gp:A)NGjې6y>ƴv087C $H{+Zy(BXj901)Zk$IkXؖ5SˆtHQ3iCVn pI1II]˛ 5F56L$+X;S:)rXg%, #n?rcm1H u4}S?ù>Ogc[ԅa'EZٷۤjװ}`OUcdWIpӱ[3$@0ɌG3SO2zǠYհ4[DIXbHI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$t C9<P×h;M ]eH9y,ũֿJ)\׎NȮt)mU-5Z@ku*6s-.'Nc; v$.'C䙌ܟj[ӟhMJG߰RvbFlk-GӔI-^['7(Z <+thVNoռLX$[(%["{9px͹{Ou4 E4.u]4۶fGG#fDPy{};Wj~A%A\T)%K$&n9}>ܔqir(ks#ERSMI>⭴|4TD12|0o>Ig3`ntTNےX=$K9*[HZ@BwdgK6?}96ݤ*M vIIw44|_Q. j䊔ǷYH j4|R,OTH)$H y)4h;kt)3H4hJKAj+4K`vNO)y앩Z] DL!vyEGh\ !NS3_ vMV{ZTH ᧒(c=sc짜 sUVp*̨`wu"K9i^v.cMo-hp=ЗEYY^~;2QWf ЎWu@oܼ$Rd$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I'@:GLZH@\щC}h:w\ ^~a6 A>=COO䳲D >(:J~i*/˰.Y&;#9`6N=CI (rt ;Уb$ %xS rx#ޟ]\в~bsk)Dm1Y,CRXmsF<4*ɚZ.m[G-ptuTZy\z^gBz]^HVBx$la(!:IVԩour~&+mex<T'[V͵xtΊ%>4iITm}nuS.!Wm:8D86jr(`XCyk`2InA*oLG9 ,s;J VKA}jWEN0XrLˈ "RRH%JgY4`:K3@.U]yZwL5 IM;k~!v]~t* <K4wN5J5ALg֫#i9STF1st &8IH %L\n@C7 /Ox DBqI``oN,Kmva \$ P١K =VKMA;u~&ii$y&I$r4:V)x PY- zd|a$%$ O* NYTo5o$R*0^!l/o~+$4b \t,h?F46/vҢ$[~Qi ̄7t,t'L| L௳B6☍ܝS XԸ#JX¦un6C à!zN;Is>*#]SN;B)ҹͬ]4Ubtu@yMEMʰ .OOg{b[맳 'gK|\OyZ'>3A>OeކNKs;ר&$Xy}{rGD#F=!h`[0H5|KӲ[@%48WY */ 17,e.{Eޓ]/]r㺍987{"1D!m{:CKwc6T,O&B%e!=s'EsH-| v3h.z~٫!> <$%Ǝò F4~Ją4j tE{Ccpm{ eVyD `PKG egPeuXe<ʶ2;PGRxP':8PSdz(wS귒~bE^4ԡT 'wò=> -nI)-6aBL!;!tI(LT.jyd T[*iɤE$ҝ R:zde8%qۿpߔsqd-MsS6v'Uj ZΜjqݩ&QwU$A*}($n`JlZTI$I$$I$I)I$I"QE =zgԜ7+NIEkXS^t;乤8Qp`}6ɜashƙAQ DmHe~H?nTN {*e(=|6ZSn]ZhpM \[L%\y,>|*nwzRm<ԁRFHj^=s'4Pp {RQ׺IY 0$- ΰOH))RS7ֳImoK}m')$JJY zF 2ho:;ʕmi%&hQK=hۺK B0q<\AlƩHqLG)ZW.;Nty!3'Bc.싍D> LPFST; r斓Z6S%38Nw&g-xiTFμK78hc[IA,ZӺ<g{hXLF\=Љ$R#h]ѶQni\(x u2x? S@S RRvO$ w#HIQ LAr9$9`pHP, 7RRR[LjxR!0L[*SDx$QRE;&4%IIuH4-H)s%"tnx5@û!3Ap*2IH B˨= 7Zu ymT d!k PugWc@kLyDKntj,w"KNUJYi9 ~GީCM8@:sxRh))ALmۃׅ:kO4ƶ9ڏ%wOS NdRR7d %=zlPsCkip:(d>vDQ,)R U6I <g[}?JÛk[|BkۙIwJ:UV`VָGGY{]ğ! IDxs{7\&L맇+ o7考[iO P59Ĉ'5dHpomB $:I%0<9ֆEM5wOJ\kxCx}C_d鎜)BTt6õ4RpPmx~׿d'<))@7̀˟m..Pl>uyEZ IK&"|^h=S^هPU&eH82tkxג{9Ta+ipg]u5bX`4ƂJK0vg\.@lV.+ kZt]tCKswQԒ Ζ^hʇ4h1V'i?=߽E2.T@ LJu=) V /vƭ z}{+oW㈭CE)^g 61y+ovWQkm(\J2Y 0Uwu4 Zx6ZI]ժjeuϒy|'* 6 j}[0^=ǀP4׺AvRTF5v= +(>\`N"]§cOT ((Yc%Z7A\G.ݺ%l7~Wr*{{TuS{Iҍ[gjukfJxa_ !=ʋlWUH8uú?h%'-]mdGT !wL5 }T9 8w> S^ r|N*Cgi~ 塤G#PZI$$uDH٫Ȩ5vB8pD$JjCއ`9(; *@I$m~\ < o$IՇZI>IBI$ƻcp<|Z _DjFAo56湱%$:b5zK=G~4#J`V1 n2&)0K@)5:#gdL^ c\ZZH|!NNɏ!A9q/n+0m1YA{ֺm]NFJtI]VUģU vO ӄj$Ի謷c\TU uU/6=.uⷘCv($MQRW{=8̼" 30;rJ,C.i.sן?kJ?TyXbvкf(챯dmAu.^ -?!+%~aէf-!cb EIB7SI$E I$I$RI$I$II%>I$I$$I'h.05%2>ߜ,$ 4:L}o}ZT֏ҼI]5UjU@ e yZK~ˎe:ܮ73$p%W2 #W= kɍ&[OwɸbR֓?9O_}v8Rk65)RZ[IzvtxN4QRHw RI%EO> xJa8> )DG &樽%RڒRn&Iq:20RS(#NT6Q.4"0O$&J:8TJͮ&t p~JpaEOa4T3YGg3# cj 8L4BpJyT0+K7YH+]7g AKQ~:+y*]<'?mB L,$ʎ0tJgu %%;聍o`Uqћw&e"JI"p,QaځLx LhRJ*.=s iOdI 7AhWF{u$(G)%5mڜ3h5C' 0}ȍILd~+:VZZciTE3l^|P%$@D}-#Q$)!KxEm> zD!K`*(<)vf47ڄ!!f3Q oI-n { hpI|>S! Fd&`. R+=[ݨaDt b wBɥ9HZ|@U,aE306M5wu?I<*:QGvZֈMmD55M?޴0q?sƃdk@ pY^I :H*C(2{(V5`a 7 4b ڷK^̒wRIpQc@iHowe6Di5"JD&ˈ $R`()LwV; !dm$)$h*Ot*3)d"hvL +eħS%F;\{Z'sAwJ{' nҜ>uQJ;9ge!ƉHiE m1&D)85(JhR0肘H -I9 "k(^K9ɜ-M5MKmQzr7hD_O8-Y8}ĝx Z\ iF|QCbrpE8%"|fe3UfDOc>$AN){_Hqg:59Z~{\tpG Fĺ?pqR{7@3z?+-]S~> mND*iii0[ɀۺ26?x0]Z)I,6uI$STZdn$(S0JWl{x%tրG};jYgbL?~: st2 w*T)C:&cXͲ`,GAD:Lw!'<{FS*;D)Ѱ~iX_Y ͋l4Zx"~JEĶ8'Tkpp( eb|5N0WIk=v<,IwuLB`DLJwC@6SsNtp&7*Z&L)Iҭ ='^$Um VC2&LBJHKvp{|Ɨcu|8ԞC}'B5ZD+$(Qꍆ'kdєn|BoP ʤktVTP^ӧu z_P8A~%6HaS0s]y.ns_b}'xpծwPm2$ >~P@ntZOyW=fq!f#D`5+P}"_;>RHPIsFDF}#{1tgZS {.}Kʦ|~2-'HW3:Gdk nfyeFͼen`DV՜,Ff;h#YDJD: 0[$mU\ƪ륿3@X<B;'QItFQ%Dsd&vUok%R158 JXKc'9zS/0֨ff8ޣEm%k %2STUp+  ju'2Ē쇗=kOɕh%LW)% IInCB뽇s[ JQ75ĴˣwƶH4V=V>P s]-=3[(Z&*1Cc AO1"/x&}+tZſv)Syc-0TII02$I%)$I$IJI$I%>I$I$$I/Cx|W/RO2~)|7R?ua1?Mw[L݀ ʵ 9O(B.G q? 7A-*U Zɏ*{̞ΊcU@nL&N>%rd|z:Jc<*LnqQHnv r-O yT2|#@D70K>m38(:tJ LBt$IU'M|23xQϒ!%'@18ZN2RSx'h.:6LHg)Y{"yBn!܈R A$m,0 g 6uǂFjdOS$ͺhU6hJbN ~ G33_RS(RRtUu 66wGQ# v"BNSakfUNf8 을̤b;U% %IE;C:_*{U'hRSWh%;I h[mRsw$tNYxQ6 8C6 3Zlw\o PkLw} .+x<*NBuz?euc<<ީ_Qۯu CwVm0-npck{OudYՓUM.l=z̚DKFM#o|}R&\Yk{k*O>(eòJb0iQ:Bu2yS )pt2I ',uǚ G JX^{;"%Y!AH6xN)H[=; ΉNJDi 7D݄8jDaAҔHJbD{5Bv@טER Z%HTIꘃ“|$ !:h'D 3TtxN.jp' R$eH6Fv'N<wyR0hwah'o@IQ“FRvXH52K%5D(_oH(z~)!\<7vl Ӻw3А]:PwVӕv:ivEH '\i{-Nu!sh<&Pa>[fP?諛cvt$II$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$]bc󗜯Rpql2Ƈ^˻)>J,Skesxc#q&|Tmh/8 @} IN:iFi.jVgCKYp*=S}a/'_K#)I+Y]ƀvj\t>(uAu :X,I10g)!JO|w=eM/5ZݠwC Q4MBn]7'S}`qd=ZktxUfyhQhD)kQׄw(Ms^HRv;+%V-Tys=R1OLSCGc&eYnp]Q.|;%RcdB"yM"֒'XL$&ڱ`᨞|֠k쥬f$?u@6;":Nm!(.{H'HXOchBہ=fL{ysy'L$4^`<u*l{[.( Jn H%~a; U֗U5þ)5<&N8IM^;{%H` B EOhI4I$@#kg"]W#\NA Q^A t܏qMʉK̠Rͩư jAvUeP tӟ+xT Yyyڐn&LKgo2|N VJ`ևw $J rz-sz5#خqnp"i丮.DW%9LSuL ;,|G`1E^G6 t̤d}f 9Cpպ>,-uVfP>(ݡuCp֝w쵯q~+?# NΛ$82U^vnY5ٵ=wz`gD4ɤ&ʚ+d> :pi2Ⱙ y#ik4p3kpSBiz:t՛\gq[ΑVo`>;)BJE99 *-4$V3$ psֱ P'Q! M,npcU39A環spAvplw`OjxN-t{h{\w٫:IHUo㴘D$|bwz B~Sn-suYeh CʛVa5Z9F.g7!׺\e=J*T'Pe̫S0`z.9oڧinT5OlvRd j]CưX w.Y ?Kh5R%)|SCE햵 U^CKLO$8ܠ Kpԥ$HaK I{ kx c૽y>$҄JI[I&"[Ӳ| Q-t Y>I<-gdPt3[r0nہd %))VR̀պHl#pcկJRU⇈"G$~*FǰZuB;-НJhI$6oF#'>=u['MYs^;IYc:|4*1~h3 JIH]]7wYwidiEsr9$9@l{[r`6 H*8}HQi% xFr`WTJ6`6l=[VmpnQe.и赪ە=ޥOaw;[ Ӯx<욖e9i i&{ 1Р]>!%)C-22LhZj5u DDeG\K> ] $E[VRI$I$I$$KI%>I$I$$I/QsZ PL}|7Rs[sOƂGkWòÀ#>+o2 -TT ngO1ltZ 6 pXk`hSz-<(eI@edJL'l%kK)Hɋy(Knir8;'yKi(q6R!>D\F vO)@N1Drh>s$9H{x&xJgڢ7NT09)@|h:B0dhX.}ڈS{=ۣ Y/UfZS9 1=s戴BtѪ1IHlGt=wDAs hD&SE 5ה68 pSRIIܔIwmyp1J9! eRh#iLl$SE&*.yoEA*<$ xLJPK $B6>0S63!Kstzw̄EgB=mJPd.Ӵ-C^ЬyvTtEM,~0cEDX[ Ԙ k)L~x`a 瀧"eN(dv1ZԱ<+\C@ t!zVwK;YJHRzK!z"^`N?_xxi\Uu- LW&WL+"p# *28>̗euv*Ja›jNMBeiGe .+u}C'n43W48DISJjY=dB/ 8ˋXOQۢA%%6}`IOe{tl{'JDQ(cm*FXӧrb0^DyW|:L)R4i:g˸M`;JU{%qhdyM=6Ik N-O(ncA2 np\[lHỒyO1RÔ~) GD$R<˾I$kCIDzqmPR pDݡ)0m'THI ] CLܔa𜻺c'#*]O8N$wr 2NNF*.$ke۹R~DjDTcRyIDkivȠ2Pt8~)[R-TsJw*" ;|aB|H x'$̕j<Uy pq_2_n[XѢ^}!}=Y nVc7dˌ[ʯNBI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I/MOs<4zw ̪ f)euVvu۷@JPa6hh"3Ep;X^ofcN\=OMp<ԩƑw7ph1܁I)I9EH-5_[%[GcVu^PS7 $JA505C&D)FE4%) )46cZ5j- qI>HMh\ZZgNQ}#RtБot15CD,f8 xKuoPq0: =N-|P&sde:F'[xf@64k&?+$pݎcrA:)ʉ?l{ZC=[bhsN z=8[5c<50C5?' GaL&ҕ C*O60 4_0$}K2Xc-SI0NZZlBǸ^<8C-Ӵ!g>%$I%$$ԟR+ ùC5+QfѦ ) Ĺh!a#1+$9n:2DBI$%##ce;!6\S$is  3 $:p9|+trz N?:Dh5dI 1I!0mfbGe^\}h'=;: B@l:$j:c:Ϗ Ckxi[qS偛Ye"D#N))cx!t>+F1ځɅqc"AM)КR׎P7fݚJ]ot5Z1d8*I)K-M^84lO[>:ǦeVm_extJSM: SzIwVV_Ia![2}!XZ@tSE26\K2"aaoUV&tct{ )- DVƒp-Х`{fw?exyt1&Gt-pDL(O$V @ni Uv<`dIFE05{y BpR:skp9@- ΃P\$)@5AM8 LC?6Or8B14BeFckS)2p*@C\ T&f|Eųfv7)5$>N]pLOWO@*~KJm(spktdZ+.k)aѡgNo"Ze6VO pTsۨI$I%#vDǚ5{@dj96 If@$I%5H["nk}u /|G'@I%$ Jcwm`68ǻe6lqp2ul8^AGࠗ:u +m-{sʶLpI$I$$I/@75Խw+X KO hp_F3 .c}nwLѹ%Wor, *ϊ hy*35Vk˜4 8D$/1T6u8'#QI:BR()rl@FG)5纋H)S> mlʎ)ˇ ixL|B{gTZ2Dn AHi$ 6n5ELu׺qK1JbӷN8'puL[B#J(AjZ8WStG,!8lznU,߬9%^lH3c<:h9Dlt0—i53] ) x(neݢS8ILZH MDjuJ4J!9 &$h3#LX۠3?5&DOJnxE IL׎F2@M%8)R@0qTKd@?0 )0N `TIZih~Ip=AH|@*$$0㵦:U=>Q%vUZ:xT VTv-VVn,~-v g̔Јq$!P @BiDQ"T⒒65IlUK8wuQ#3[T`|Sldl+22xYw)([#ҐI%7]2dm:Da6*jLR:.yMϵ6F&"tHQ )0ths/Vt<''s IK `)ɑ'n:8I(m+["5*]q􂹐S'S͖G$⊛\Ky!TMMlT 4IQ"V`{kN*n_" |}!lw{wvTZsGrYVֆp)NѢrb3NJgrv:[0NLnSܝQJJ@w?xpG)1&r`{ aoqT*`()JapCvka"\HFNyHM!({"gB_VֵevLOu<)Ogj>B!TTUW3vӴī%Ukl %lV8zqd2FNVk[7aUlc>!sNii N<%aKaS c0UX+{vM^ަet'MM yk{.}K×}FxwX7[K~*@mćX#N/R] kiI$I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I/n_[G0R /wHX[K;rh+Xjl9Y&!~C%0i4Q!D҄NI9 [vlUqkǸIP}2'z!^`I$]IQh l\{">ֲ|?6K$DI7d$-;\ 8GYo->OeN7mNZ=M-&7R1O\àO?`5n'*}khkU ÃZ &!>Lp[wp(lDzݖXYn;2Iu4$&;2#L:s. 4':9 J5d5XED9'D2:HC,$HitC@s:Fk!ڮc+ҵ :dBާ.kA w6> C<G U6 4##p q#qIWRCj>3OK?s[OtI$Pկ!w$W@-O{{.B>B`$'R׼#,ܴ ;*sQ#Oyd ~i&N Ll` ϷRnA<~U{ z`IG{5t8(2P) `- ΞkB Gȩk'ZէKf"xQژו'432DI>P3sFuUq@sIx {ݸC`i)&%8H)b1l҅oӷCμ+Xwx9-R$kTD)SDKK}`{Ms-ٓ#]ݬuuD-%q6Wf=$GdDv|{/5;P{*5|WknxBxI0)v8V[@ =v7Lzk$'M()3cSkQqdHEe;H$̏)H֖;n#ݺ8Գi9Sh(Nr~Q E}t`QeBKIvޞqW$BPhcT $+{w{'7vr{'LIZbS ŀ$4Y#MM@LIZ .\=vNf9:{wh|SD@)N hIJy%6tgy+F܇Y46%:bRL䊚`I#C}!Uiѷe6M*Iohk@ѧ `!" ioT[$[dV8 i;(c"8;vMʆSI'LI%1 !'P8JZ_O0.%DZIՆN$IRsֺL&eqw|X wwy&0̨"]80RN$Tp\|N5S,Hj6d$I$L.ca$ aX];y!؃F {$I$2^4 =ct# xa&7q,?"Iu"9*X;hxXI$I$$I#a;m!)9 )J iM2wsw0!gt\U]ĵih[+-^7ni.M^>.b!f*t$QQ 7vU4sOeSA!I%)^T G=˵SJ4I PRۈM3ۼAv"I)IKyw*"$% NIL˧<Oy_d (IHxt!;6I}!K`eSCLoPG@)DTI:kp&dF`IH@3 EJϥϚRs@L)<~nj$u)H00nB 9 tTA"$}{b@'HQh8$@/RƺB]`p($Je$ӻWwAKXAfhUUfP*lPUΠf]uiX{4p;(] U'2H-tj/ L"|"`$Fc';@${a&ӲpKBH\:k&8 NISʘtjb$|F8)G*e'a`#PT#BMB\yw*P|S k :+5Υ4h  Bw,\gMA;yVTpR꒓7(D\6SiVE"S4w)NLNC;AQjl8Bd#DiRC,%fXUۉc E~(yn1: 4L}TIJmڶ$۽ϒ&D&纐jBj{ Oe78;FY4JiIJ9&5$"O)"L8-#ɀ1DO:2~JS(wyL`jUy=ġ⒒18Z{>Cgc~fyW3sHb(x-@M%9Ρ MՐHǺ'}-J bu\x]Pn'FT7Tugt μz!򸓌tU(XĮ[iT,Xv%rc;e-wV D\AӉmMm{ZXAI$VI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$IX~U ͍t :S7T{K`hgď!buGHϺa.O4d<WIOf.VPgiZu 1v1W2C:ۤ*U]Q$I"cB'v5HDIhz:DF$I%/@Fli/]P̪@J5l:G %I)ne`u7A^OMNw rJJ$’h@#75Cy.ky[c6y*%ܥS] ]qcCE {j14Y 4'J>C s<ɼS95,,g`Uٹ qc=5t'QT&U960Aq1ƫjֵGɱ2Ob-w t"5M7"{aIZ%*]}&>=s kL'S98Sguٯ~S$?{ya`:\wTNE p'RI$4--puVٻXξI;jTFiay$I$`5廄< B4#4RI$)oWxM@kP.c.74IBOҖ{zceh\4eo<5h:^4:r d) yWiʈc P״5%IGaK OFw*Ykk`%6)װ ( 5q(g@#'L6cS'POd lQv\&<$tII/c =W{Liz`I};k.R!%'}ml seC;fR!;NB9hN%([ FY`JV;GMk=6|$I)t;`y #=D+}֗e$М96zlC.l 4Pe DNNQM)OMm>ֻsקmL Ox,ގ=Cmߊ>d*ۅc΀U\=8?Hx)w4|)&$SUC@pXsCZOoJ" ='9`:$/j~hmc>)R5!ݤ&#q 7'uC!$I%5s":uNɀ!Dl $H`7@w k $L` JR fawmq*?aZФ+" H:I&> )OcM܍9B6 tK48@Oe [lw4?tZÈGV&~Q`{TZeIIEEnWh p`& ;"ڷ <&%D')Υ.JZ q7W[6@ p 4G" V*$ #ND&%0}LC̪K}Lath ;A$@ n%-}6DI$I$$I$I)I;&@Y GQvJ{g>13ԍ,h=};KMcIWpjOW>2=Esԉ{]&A:4;~i)!)LLYO!prH:xMR)n9:&Y- fRJtЊ]dP3t'A,7|PuO0tK` S$iA$Rș쓈 pY$8[HF t(X &9:#jgSR$ %AIQ@჉Fԕm(j8;&%KӃv )c]f.ۤ*U6O?HޣM.zXI`nTu (d=$eM!n2|!Ik\g*ØNTndIxMPV_8 4V5ˍr; jTe1i )#~ !;L(yN^"x%Nh$GvL꒚7z]ղ_ ʥy׎idV[`pdPgJEΫezgΥ]mIʈ{$$Q:JBBacZApy1 Xpq6 na1+?SZ!I#ܕW[vQ;t> &{6iy)\ R)=7LN<'8g\T Vm`0L$*5x9$ t)8:|Utk`Twg2gxQnU.Tx@7h{ۼ{yrl`X 4j\y~itE1uI8?[ |A<6vTk;Ykf2+@w'gƂ@I$$Tk>4v +> tHTƓI$K%2 vt_J3Vc ?sTKw[l?y$&IIM o'U;HgPs9Qh2>$tLRJ{cǒE:9PwyrƗt~ZxT<'W6+'fčLj-n FO<8GZٵ6&Oܐ0QUfiiV[vnj|PF#:bS|4y#ZC}j7cl-t pRI$ ]X0nD9/}h!T iyqH Ҕ6j:70tFʪh$AzZ:-hcS[ԵI$/unAXD!Bpq$ZMI)v[ۿ(/;u!HH11Z䎩)f{y%'{K$ǥ?|>|BP%I)CA/a)Ϛ\ w*Nh?W4I$tঞEcğ6={m n^ۜZ JdQyLBZ !i52R/ Ұ,؆I 蘖ֆư5A,oZs?8EA.qq$RNjyi !HHcu92\%)$ d:u?Qlas`\ C{MgsP#NnPalh>p{:qig4M )4^Q==C2qRe̐t'H&O )7{I)X rAq ;9J6d &I"Y5'MC~jpS xCI$I$$I$I)I$zWhjz}:?8O޺fe_!ձ5fr++΋-v/#a:5DʯP< 7: b]:O%Gh81cG%@ t'D$ x H& Mth1>5MS `0Ӕ#RwBc$BPx'LP mDNĦJ|Sj1*-!M k(N8;EI ÷ @4Ql#`@p6% 'S ٤mf!He7L(%!i-($7C2V7}oP"T̝TH!%1khA[IMEH8#$@g+Lx-PȬ)Jb|RR95F;oGi9O[9LFX{Q$RSb~(=O:vSvJMe3*?O'8|yO jB`a/ OD*[L)H()lIX&-B}&k3RJ#V#QT2)L(NQR=R؟#뢓]¯AYv p ^|fL澑 \OeKt]I$r$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$ΣI^NѮ>V=9aY?yzAjW]w?uf9h|ВM BfrhkAqqBmi&}u5erKC*@R|SmpIQ|GcDk0I(I%-m1@3Jz S9 rP$R̸A?qyI/!xxIƍ$p  x#]tLs,M@>?U\g扐)fZDκ⤒Is)%~cCbk68Bchd4j[!:i3!A6UXo聩(l 80P>缝M/;&.m2[1@u;+ -۩#-?{W,!EmCp/& I$4@JrT N&e$170ể.5>RFaC#kLFR'i#k͗1F`J\ DxjIIF7MIBwV)4KGB4p$C>I͍k&L0򣹍 Nɢ>)_ $43SS9yZfTCBERJuAF)ƃU4cZG?*NqJ`[A^4r!2]$I$IJI$I%>I$I$$I'hM&Nc8!V$ 4 Ued>%, >48.ɰsU0 YS vI1 U=LY:<;J?)=&. tYLH'ЧhEL*Cq$RK8Ot t2|e8 $HZKL2Ay p?zIK] F:@uJI?'$Ďú,ƪ/h~iI;=݇t7I)3N3ƛ 9MKZjx?Q&y"{8IPc@gyPc&rvT8N g4nM )|;R3^, D f?RSQB|t~T 9L)Li%. 1OI㷎xKW @$))w 5Q!1 %#4ԙ !<F BCM9JIKFjI*.O[)dLR :2OxjĘAC?)qd]iS @ju#@|Q1Qئ9*2BNeErufS "BI4IJo(衴:'0&d&S$h): $'v-BE/$IL;xqo*|{tRF"1"J` 4Z1 (O9:j悘q1Yw|XF0t *;JJpf|@CJ!!xNnE; E4IHxnc4Iy=0j# ~JQ 08S"jQnd`Tw R#0JIL? ASH;Iwy H{O @:({% )wA,"e AӲqk%()L'EHjp5!L:wLr{R$y-;胂eO_SxKrHZ#ܕ!D4w$@sh B ✔RFt:|ٴ~9H [a)%-;>NyDprJ| *`lw_$~<·@{ſDX_YՅcy1#⼤{FK74Ⱥg˶>31dT9+:uqFֱjcy$*I$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I+m_ zyZ; s*~k /_b~ hW\SZD5QJ\,/Z ~?X\/ $Pc?T}gW;'JW18JX:G)%)IHKdϤL+NE{CYyL ٸ 9HJHY/xnc]gs[k/{!N =K]ެ 5[dLx%2I$jx7`y!{ZLJޛE>ID)$%?I^`'@ՙ~ƶvK\ĝcP:pSIIuKC%1xoV~m- @Hn;v{Z]'@ 5RQ)I>c:lkAџVӦ&::P2ǸyGZv ~Ksm^ĕSD;AB曪&vW1~z -|lɱB5dU\$1C4{%@ ;t7D8~I$<76P{M-yے7'o؟LI)c#I$UǏ⩹p%:;Op#'ǒO p{[ jcA*"?Os$3&p@pzMiKU 4I)R*6%AhjUKZ,u?(D3ykO: (ܢm. s $Ihclu&:'Rם=Ntĺղ |\w:8N  w-2OIE ,NaCk;d$I.p5-2 hN4I$MNI>q ';=?R`!X1HI(I,yD{lRѮR61ph۴( vxӱH$JQC^ pJ7hmn.q=#^wI$SWuL$$$#?6%Aa!>=ve:ba"aDj5YYdnY4cc71BG0TݍHIO K>21TxFpOpd"p 2Ӥi^g7H G O!)H$&K2-km\s*yP ɄD U? `,]-o>x]&3C)J)OFTdVI;-j]YMf3^";pO=˾2'U=ҔM\|FL®1ûh$i.ְq%DBa iBk5@uH&}$OdGdS)2u7kʓ\5q;>E@LjS{CAMP6H8 TCG}}V윝'%$X| M/$({g6w[g敡:@RtRxTHgݤm_(sOxFCvXf?PP0:I$HRI$I%>I$I$$I)bƟʠHy:e Q)` Yn`o/_qXwp~I㲯pD=r;LZ>恨q? .\y>(UfmΑN<MH!tv)7hLO'U/k$% %1 ߊbD$%(JR?$q<<Ɖ$xH'sCB'1$*Uxd:#dƜ'ka$~I;Sj:IC6Wk#V$j ]$HCLU+Gy: 1NN31$jT$e2IKJI]#`](M@9$.5&0{[$!)I+Ɏ;t ߺrtMhBe K$ IO tO;);{u3Iw) w6](D[RhP̝AL)Od ,!$#=4Q++= ]ۄ3ޒdI&TFa;5m#H:W CJNIκyܽo&2.˵ǓgK{Gm%zOcVG^GӨ{@<^Y0੤JV$$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$qX9i{̿b{ԧn{BXF]2澰 ql;& XZxk>FCȬu" xK*;HJ5Hj].n`]cvI7c3l~" * trZ\=&!,`wR-o%X2dS}A,2@1pw CپD`$ИS\u/P9.C6mx.ragpJ*;ɗ6 ~I']~!Sc2yK/{Aq &RqM)l1h{U_[[mʯ1'qoUmsyot:I!MՍ$'ڡ[}S\o LS@< n\HhBa-'mXRI4)wgcȌLjޢvGGԦ$AMQۋ@#![^@3s7]4Gr_P8)J*EsվlcP; Dk)|K(A)&g<}?I?u5=0Z/n9J(JF@h3Tj$!Oo} KZXӴh7G `8Hh[D񠲅j<.w*X 望 gK, )&ɊM3%kaѻgr)5p!Z rj$jR.L\a:khQEs)(.韏 : LQ#JkiS![hVctPRK{hY9p2@ QKu2S!HI )Bx!=$VumpL`G?wsCu#EK<)`- N.AVv/;yQAV: Ȱ7]u#g8:I$HRI$I%>I$I$$I)Tk*)`&)/lK]ޒ#Q-& U`>K-8+.[=<ۃW7iCi)3Sߚf5-ИRFtݮL4 |ԘFF9@A&'pJRF;Q䩑O=5I JS ohԷH$𛔔Bm$yQiJAӉR#U{%"B0r!#1A*S%22dI)J~8.a<1?.SLxD*BcTI*IiA (ݔOdEfCU#YY"\x(sDO D&Ta |Ӱǂf] ̷(Dͮ tx߫T gw8/⒑:g]} vHkQ G;DIKhο&GK(Q!I"%+Stʛ]4L0th>j$x&!9hHS;M{dJiMJT ?$A>hX;4h9RbU0vq T8QYm [lGe2E x"4% |4!Y Ry yHH'%.'Uݺ)M |DkƒG ^6\t3GRtpIQ(bf1E1&n9òr:(d)֛ (<Z9h1H')8T`*Iw>H׸U8 BS)'LS[#ae0Ѯ&4tKZwr@LxQ.1 >I!XI4hOE\f3lTFCHwA 2;Ywi&(5I8lg49Uqjp;C*>nv~E7d"u_ [uޛx:HGB//-\eKK2w8r3.?6sZt `2"4tD]RB4%qo.!%ulõN$ ~ ~Yu tp'Nfdsʹx6װVuL,vwS2'UNPZxiZmv ].&;HHt^ǒZgT -=:k({[S$Vg\dR&<')cy Uk:T.c{½;$3' pT͌@yhqV͛=Ȏ scAc)wJ{PfK4yT*nlS=i,Ï&NI)M t0|o x'& TI$iqj_Ӱ5GDNSϲ<4hO JvV.B(! ]H,~![}:N%02pfrW%Í?uDUg͇ )BI٣ǻ]X=i=L#c1ɜ|:ϒtm,NKvJ4#VC!߯yA5a%I& $5,a y!XAmLhU0$$)$9:&}mq||RttBIhLƩj6To .{uG8T&cf]F@鸁|'E- Y7H9%)3Y4IQ};| [['-$Lv $?s̤HB6˧{'^ Gb5?ޟNJ`g'&|RJ -kDd$mMhDo%ONҚR4j)L΀r{GFGu\wQsTzHU׿nWI`OFD2t=ku@FEUծU*qupI$BI%I%>I$I$$I$I)I^q5l'MrjV:%pOJ.[!ңY!Sw O7eZw<9p0!)9Lu h`ֺ$ hGqnS78 C♮'bSA4$\#Tqy0"$B`SIH\M[p'ᢛ܄G ɣIM c@Cn;PZuh-<(8)ƪILyNܒ{ ƒLOHpO(-O $yIK qphן rG c2E%2)SB~S6y4DI 4)*$BIm1%kcst*"{f~vȵjAȴ8Y<<~r0w*A̐x:DBxB疐T#ҢӮ@DО!7<$WrQt)IS7 $;`y>Å1I o4%ZA!Sqd@)SߺI]*`'A$HsJ\[$hlE` ƉqQ Nd vB;I0ƅ&4A,L$LHLtp@d4GTGb0u 7H > ӄI)hRNO`O)M)ILHH)A*p ۅj%29Q= >9c1 K1(I[GpGhJ@rNSFY0<{jiBPD!.ȡb!;A$L%3~IJ*#?1v\;g@O%RL䐼qۺ`2Ja1 %9LKK&Kw=Wkƞ MWIS DvCV-nhU1*p:!)GJ\IIF4n (o#@eHjSJI%YB-vBF$h^"R!( L:a  0%Ѫ vNP$xI 7LNZ&{$!089Bձc-6aA:/!Y?kɲÜJcɳgKy+:ij{B򮉆TLJz_dIJĕ$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$^,l"8+סܷYO檜o O[i1 T:`=צh $:Oe%O/ }Αn>:d%0v+1{.1cֳ3ؐGJG') \asxFӭBY_kPƖXL52R El8e1IZ ,=WzqwNN(aImm#PuO2a2@G)&e<Ol•@fI1JSaYS6<v !5u04[jd:JY4~l c;'RLJ& h bMS:UpPN*78K:jIA+V\ ;yd\`rt@wDCC.OQb)G{IlRG/L0J[op- Cʖ[_ed=1DJeђҭb9СV+qc8%Ax2dҧ^#h2ITj!p+X vL $@`jђE{3;QpH% ҄pC_icClƈdnwOH$I%hԕMn8 aMcP&|pSwaPxƧa7۹9Lw@{x=I:I!w4mv!Axl?Q QTּ8L3S$$>5n$$`,O%Q=HRcvIW7Ip0|])PFC6&y1d2LBt%,s%N̘lǗD%ǾvLI"͒KY?PvCvAsGW4O?LG3ZP@ -aAHni'b8%ͭؓ)oq3 .6<*E΀cQܥt%3~Z'}c`hB 4ÔpIHC|L'C}Dzm~r;&%,v.$$a<-I$I$$I$I)I$x=av-@\w |gƣZ̪ܳU6jgo.WX|xOv2eZpVa\́:KyXv$-|q%M"a))IMr@?.ȺAP@Ӽ5ǂd$ (! %k@Γ+ ~АO vD…P5+HR:`$!{w<}0#_:vO0ObNkʈSHj$NJRR:m':p7>%"I1 SH#O$ O1T@:y$$$TēI3<L%2R"{A|n$ᤨS"H쒖ZLJ7#NFQvES$?$pZc) 9Q"JJ‹읇iԩ*eF5N8!% ixʓOs .cfI IJsdħ  FR4)E+K F˜9Qii$~'D(#np: A7OަNISݦ'->uXF35~(()ٕD!Sp _Q#1pR$%$ReA(NSlJId\H 13] w(;5ﰞN#ǺwNLiv΁3hjJ)SXD=JLAΟjQ!8;BIL 艶  yHpILk I \yӎR.$RiC]AI-$hʐ4)wHT$@NBqcSIt&LB#ULqbIKN_I$Hy{J{&aHxR.qSkn֧LI*J`'Oi'](u9J5I+pؤw>i)H"@:JX65;L>(#BBmI<$g`9NA]aieO?e.$ix^Jι*ƱJ$Ñz5` Zu RI$jI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$Y.`=rkOOٳ(ǏRk6Tckw4#u>>wnaۺ!fBcVe_h}/0`S84C};ē14VisF'I$rK7黉͸Au%\ycZk=Ҝ$$M[тMckXW_鱾'ii 6Nh#FTc)l22iYcVigN;6;&jkPƵ.uPsGHw5[|"y)$I% 64߲%vUt[+FI$BHYeL6$ CNxڝ.uSyAR&]y1|THZT+#UJ@t1P*j.t+!zk>{Jin,q$7l5j&{@;$ے)4)@ՔAkgS@h[lx5q18c6*M*%L3HT+Cyuglb洶?wAf;H;;pT2yO<+57ĞdV%ih֑F5]ռXP<$&)Z~H3(2aԷSC Q1|‘H({Jףs]/'WD><- C"t:j5I=J) dCNSh۠y}k۴DD7*Xjhm!JnQ @GwZ,ήq-jΨhW۬N$xʎE6(%053lq *%엽`JHmТ)l-//^@xxxAu-[cKDd+YKIb;sx,wϒ[-:% $ m,0ڒ;/xq|א{-y;$H6XQ&7DBmZ-nR#ɀM;}l-uB~Wem=UkGot$4m!n.pFS:71)$RCf) 8{А53t8>e$H'IK0}uIލNsZo3m..ѧiI0O)*bIȈj=s 0xTXthLx4=J870аӨC5.OskZcI' E,caiju$xg_^yѣħ9&=\;;1)JBGh6+oÞݭ3Ze'OccI$J@ƐjETI4;dNBcmQRiB['SH< tOaʱ n05J!:nSRnG|FHh.0d*[Z*oؙ![ {IdAMt{%R IQZW5Oab ;Y C' o1$Lu>hts]#-$r`Ai GtѶOIH1{:x|Sp#NSYh \uZW?F.yQ2(peVd69M|Wekkw2tsNI$I/I%>I$I$$I$I)I$-ӛJ{|$հܳg?y.pV0;Ceno2OyCA'o8OuYc2LsU-֑jwY'0Q&HR )v3CƂJ 

|w7i AkL%,xS tײE)JPR0NSR|d);anR*[loqMB}rqw2IM{[ RcI @R&& )3@o o:BoLD)L))vAi(2ys] )r H9A͙c NBD})`\5<<$JDb!P 8EgܤT "))z٦J6 ah5GNf)TyGeF4|nvSDiU6AL3wp-ӲڥUh|ƉF{'LJ*a[D`A<5%2I hRBb`jٴ̢=4x^G mJ G 8Cht <(x- )%` qxڏlpG8 TB(bK#  Lt%<& K!הNdy'2CD&( H(h2EG4қĸDa"N*SyHx"']N}d)&A lTHMbdh(wKtL^b{$ӪRY 馉:pHS#^S흤(eIg"tM)I+@?Bq)ƉR~hE4R%F)+s@ANw @7MT^;=y9<xFٺ6TZBY¹Ϯ-<@u_^r.n3 j~+V`(0z~Wxh2Pf%$I',RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$S;o!%)$^^_:m[2Pw] ӅfU΀纱˜+5s8x.z^" RLCXm$RKFq`/!H[,{Zt"IOs]n[Y$O 2I$S{@t"I2tCS u ?آl.!]$LZJ%4Jd(* Ufp0xSvG7 tH!KO'S'R msLB~ِhxLQR;/ EMV@I=ơOH:* 2jB!J)=̻Q!Gq*vbzvNgτEF>ꜧLQSبQY=3kpXl|v$cݠM Id^U[&NXSGӈ& !2boqmbKF^Kki$HVll."`x]D}$Ja-%9nl5Ԏ'),;պ6k?ƈNyyq"wHJRRn!Ѡfgwu A9,[1qNBbHjU@wFeH!>kw)/wiʉ@TNҝFR5n&yTtJ5uC&NQ2E9QH&s{CHES Z=6V)$I1) ^ФkϺ5 >]퍲cO$v tpI~ .7DocÀ)JRI%1k\M!Ls@}4d@'q` RҒIEm{ִ̤p7d⹀k#4մ\#d!5MlZ(wtߥtH$@`G] YpʸWX$F56$5B=C&I:d6K@rK_ #W4 )I2t*Hx-gfXkƟ\.=@V mqpR'p: #lmqs6A*FOOp^_o>)$JM4:i ``)c:6e$w0i1I"DRcz><|O i@>xI.R}t8)6&U2\y*LijVx*ߦC\G jo\gscM5~Jc%LtI)\EB\9󓵮uIK* sƍ%f9SDO.)HH`2w^[1 4FQl|JbLVחAv )ԑ"`ѷVxvNprx XZ~:(& K@ W!02E}5iEז5N8'XX}?' !m<Ҙ}I:p;QVHx'MDItn{I$I$$KI%>I$I$$I$I)I$my4Y滆ݗV[׉VeAjgPy >6un^ErQQP#Tc%kElnZo HׄBbtN(5ԔY ױ*,~ tQfǰR'#s Ӣrݭ6iE{)$$oo әxApJRs]wt cEY[Y))ɞTSnA!,>p-NDi*ZRSN_d#P׹Bd#Z$D wPЧ5(J!-IKopNN'G<$)m;()4JI.@|QƺA:E5X 3]H2>J[D0 LTBt%6ԃA:ƈB4Ds=ɔDtIM[N=VhL'h< HyIxdJd} ̧0BJhII& ? rt)LTCOxNTcJʅXeV7 @#TTA?%&:9WݻeD@jTTMB۪a&Q@tUxH%6P'n*L^hhKh{ʅh$Ɛ)S9L DJ*KK`ktV(m v 2CDK6Ў e'm,>vRE))p{o`djx*D $F jtvtHx9)JQw)8;wRDv)!#6I/*\Nև%q s ZCm>&80IIr,l$÷ L50!'%FIJe4$hskvsVSJ#d2PJV<UL-[wYn ϙF|QBJAӅ`m%*X6V$7 :) DɀW+qLP̎J;kp=MY tXyFcߤd x,Qs`nOL4*Rs%8(`?zmөMjE8LZRK6o Skx0{[u_Of4\{p^nspӹS+dh' 7V̙@y/d[͚\kw.$z:0p)I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$H|S$ IJI$Zv%Dh[ 2Y:Nsyd? @pzyY1}N,}{$i+ ~遧2 L‹O%fHsFx k-0#hK9$@Y:T!I:dS  jΚɘ'm6$S$Ѣ)U#}AFN|%e> 6Z\BI<% tYO}hCXI~kh\1~rJ}G)CDH G 6y h.3yRmZ֛$'JcM{'%$8np_]u>tjT3}q$8 >i)N HS8y*R6DV7K\{{"PB qǀά /:8}jY~hM I30g8. %O})ɒKS%OȢkqۡit\&Z\#T-'u7W'g ppдv% %)AIpah:?I?w=ݣ㸢:$|L"R8jTV0X\97cQǹ$v@Nƥ NJK]A׈ lu ]m-dE׽ ߲dDlr]%槔`q71~l9`2q wAM OY<>I]r!3m'ѧ lғ1NTl ѧ^g$A?Uk 7m@j\A ̓J]N) TAGchϲ!D#%{F׷C?OzKpHh&ݧk;DGJlHΩ_n|OmcsGܞS&x:Xaw(c5;{ gGWt0NSJjXt{+ o|MPlv68_:d)0 t O;Z6,oH $btt*U~t>%4gB\OS)h%":!iS*5Q{'5w T yl)T# -CՃoiݮ>E@{\>)e<#_ȝӯ )#x28ilwr`` F LH@D|RR;ke u({ckdҦj0BwN?w;:s"_2$%X揚z κC!N[='S RI%ѴTI$I%)$_I%>I$I$$I$I)I$ԫ!zg7'5{-M{{Ty,6r~c\g^'x/}ɤ_S<9/꘣ !?"w]> Bx^qjZyyO;}pK6uvz@sd,x&W(߭Z=vW|ɕorm;u ǝ,p6v'\#OP\|jR\A˭vTtzSv3_?_ ŕ s +[ZylA>8%\Aj/@V ?{nⷤs)κ}ep\>Hn{&:>*-=-qOL+ER;*LX67V`xAHR}mt(lk jϫ9PsK|E졼 !-jGd-]=';åx)H! IN4GtUxV+q. PkIj:q& ,ՙqk?"dX_d?\~x{V#';#t, 5 ω]F[C2z4J 睾88W^Io+S=c6>+?/stܧ ]!IVRkyr]f{sS547Jdt[A7<Mf5h$)H-49Ψ-iFx`D S|Bi CaKeWTD<2 B'I*KskI&4SIGyUȖӔi q=()N>%6xp NֹiK0'T$)E yn8 ,lQ°+.$͟QDSGc1*WX^xk?ɵ廆#D`{#3fECNKBˤC#rzy59 #oÿ殉AB&S€hཎ \$>m.̭ [O[L(iBM xq+1*iǮh P:"XF5 I8V6b^G< ZgT׃ӴG`?qWQcg$xLE -ʛ)1gL-m,+$DRQ+領s@uK &a@D;A*mD;ʱ9*90%7@֣ AYcX3P l2&T˘X@rv&kTHV1dt=1s]8K~e<&qQJg!4il[[E:%[mƊ2B#rI&|jk- ܩXִC>)V=&jLA"# *j$vS#Gv(̉QeB8<tNک#v`sGc۹#2IK!c`~Q+k(ms{ mpIݪR:g0~8K] t8 AJ%$?@1N H쇎C=oQL߂lYlÄOy(:')BZR9O~?/lGpT mnNXգoTK|;A[cT()WI4ϘEk@:6> }I~ 4 ˃`8$ LsP 5Q!Cp%!wl?/`s #<]mY,cô[WI-I$I$$KI%>I$I$$I$I)I$Az ˹ؼzG,tͧW-M|^CΆY\\:xoZ҂ﰻlSXlm)bǗgF0vl.y6}u!?TJP*fk3UaE]@51L2HHѢQ A2I&ILH(%*ĸn4U[FIQdݟh Gk!§[k`tNY&T`-Ǥ%vnPpLObLGdKQIJbBv|%@6S۪V%`)P6*E>WKS:RJ #xkߌw7ܑǴP*yĶ|d ݇iH8k Qh75T\98;eMR EksSi+˜f&H2SJe@"4$ #CL,]D$ 2t$*RI$I$2I$dI$I$I$I$$I&I$I:I$I$I $I$HI$IAJI$NI%I$I$HRI$I$TI$2I)I$tI%)$JRI$I$I%)$N8AK&Nt'IK$I=Y6G)$ؔݥiaEjc`ɪ<3st=▷GmD':$7N\_Wa>4%ۄ q\ 8U{>i|jmָ\u%(µ( g;`\S騶ܟsjIHƨNI$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$JC8ٕX C ܺeԉñ^j_;f|J>ɳ˝ .{89$jOh]"m-pkx4RQa)˓lI$mIT\湭N\#< `{Z$p&d)tq!OeY@48NJJaQ,k.30(Gyqsh ݠ q~DuuѺDRj8ɟC {zw@&'TDL0ZGf)4AEE/&8Ih@rs\KuIGaD5jP1mMώִH8x3 0ď7PK.;H 'ID8$6F֓O#IN7 + ;]Cf9 s?))EMvƶn?;qO?u:n2"kZ}=pBpeE$'P:z~}<V>2('.8O@J;(nا4R}2k\ 76nԭ)3¥mDx* |(ΩjuCdƾǂUKGkX]?QC ߣ~J#Ul5NR p *aSK؄=hL.NZY`{JCq $IJtPi6"uSY=V#gQX =hXӠ$MR$١=woꢷu4$'OhN;cG)=8|RН4E7ݵXTwE[Ĺڀ-;.&:&O))-V6->'c`c}6[Uk}=$I fy%LJS‰%-]ͮ (c k{BHEc 0SaF#&lh:f:Sb{)?H>+Jw)R/3uN=1/aAq$ԛQp;5Zkc|3^ gP'Gȸίm`t<@PsPSh \5tc:VGM$Oz~;k6]TK[&J!2=*mm I=KbחatW)̤T:b*))%T @=ꩺkn7Y$IL@ivISC OP vMdNRRL7]{$)3o*#HhRLBZJS\܃K#N{pQkFTII2P&HHI*ntm-h}F9J|ԡ4))a5"z-)RK"v­\ eYkqI.Ra>\p㢃h7XѨݢ\!<5 | r0納[&L61aly粖ԶAI*sݻ_č7yq&6|TtY nHrJg8$|5 Fݮ?qC08V(.^[3ݓ]~^{Gbauwf~hf>s{eltSĕw[8E",I-m$I$IJI$I%>I$I$$I$I)I$Kh8\J>g |x|tN\z7W^`Ef`6=h BÇeVp -G!a^>hxTw+w`c5Vmq H)JD7z~Kkjа/3WtNJSu# EkR DhLJ)Ji) hS&0"5rR DŽ4G!,SLI I'I2x 9))I&L\|EhHjJI(?2xNTMI??ikOT =ɮcnYB~u)R6$"E^u:a_i?N}&8 rtu“[[.0Ğ}-kI4t%J\5gkk#̳Ԑ0BA%x)D*A85zŠdIY-$EZe+1Hv)IuQp$M%pLb1O ;݌=mUɴO~>GAHF#O %ZĘ I"4 i 5;*j.k\ZLr\Ɠ#E-$p<4 AL-pg}FvpGR/:0 AﰵuiU.$R;Z˶?Ti2I=Y8I\VFS'LdxTWg+nfPLvwr BtRp<^|1!.tQ9p~fb[9M@'IH S#uX @ aDvo}> 5IR% !D6n^6sxTsph1Z}'uj TB; ^~1m8+`HccSZUU1D $hf0e 5BF׾]lm\I&7"xN@shX6$Uz[I% "%ˁ1>\$G%$yH]ķL)! Se;@'u}Ͱ {c#(S҄ŠMK-L3y2H5Q]I.d4w!"dTvkAL{NkHEnX,?S:ub<$cf4kS=Q%y4x I"e#'6)_g Lw ^ lGrri)ƼI'iAH.eYua#TXD;^xH'K5al5⚖fC Nm"騻sx}醞 @L@ mRJnHD$;SŦSa;N:y.r):G"GJds`% Chl|V{AxORt/`էoWnl.hV+lI$I$$I$I)I$H-m(T]fu[4> 7<xY6q.z}]O?^?QJNyLTBb;ڦɓIk0Q a$$R)50 A*SZPݳg?VxS rvL@ }!5!Myѫn-*6X]'{(4M{W['6< *#YGf9sT=0}Ќl'6=/\N 1c s+cGPrihӽG˿ihwʥўL.=x=ԯ:߅5 Tü yUUܖ^R0NOtR߂ Λh<+C%dʃZaܣ0j` NCxnTso =õ۰V-ޣ|KiK͎Anw V'Q qpkanS3;Us!PBN1zuemn a^G U$ʜS2=m ԀHRLVI:I&N):I&* j\)0QO u*Ll`% j@46u{Dj)rCt&caHmlsI h#; 4 K ES)793s7J*fL)$HHI$I$$I&N%)$I8LJRI'I$RI$'J%$$&H7FATa)J@;O* :L%3I$I$BI$I$I$I%)$I:`iI*I$ Z;8KS|p5(%E1a=.nQoJ{"XCI kš i'L%)2tI$' }JTRTzs ?Iu:PSϤI,LI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I/O]9k^`]K^p^#̀g0A}Qpkʩ`ꭅZ˅[wmwщY ;G+S hẍ$N$/k jw<p5VK[;|R) )^f;#4G1kZ~zuݴI$$Ʊ`0K@<caHXY;'CN4LR)Jje(h<|Tk-Ͻ:@& JbKh)_f$i+귘D&S0AL;+pԟ$3E@@)^mѠ!QvC)OɓHI-+8Mݐ)o=*;^Q 4h&qNI)JnfQp?p<lzcI FUGT˥oU SPIo)yL@pK5N BEFxM~x8)L$)hEHXo>#)-i&wV孬5͗ IҞ詭sx~k7_T{}ۈ6N<@CP M 9q)$ ZÞg11XxfU}(V{{RX3hҜ$IktF?(ppF(VAq ;scILyH) n,wb\ì-|"yP{ =LGD)c,a&?93)sD̼GP/qnNB5@sܝ2I&qY!Qsbmih4-@{"| [5$ɉ.nB<_N.5ȡѸ"Uxt  T XǪXee'V\3=W+BVna$4cw JrS%"]I]f-t#P]5ܞ9M@`Q)%"`W'sG⣝#63w4 rM|GtKۓ Bzjuv+dGn*\ # &dS!L53 U^5mA *hdAI (F5-&= /? BL[u?qpt>#Tm]ʌ&$Jh09[kaZwi*O 2I6ܛM>h)x؝J#M6?!^{]G 1FRS+C@\ȝ]0AI$YtI$I%)$_I%>I$I$$I$I)I$H$%gI%)3 No?#EWٯREvq3s+}7Y9:R< Rڤ)&NTQZ`JQE4*%.@5c!clS$@v!rzSFJfQzo}'=mrqVs誸[97ĭt#cEt*°bvQ`c ơiª 3lCQ^ CyO^6FXrp_@.;֏4K5՚^i`5 nv[vִ;] iX񪩴AAR4ZX69%DVc_ks'CƵZD+h9AtBj4"LTAo'^ȒIfҤ!CtUg*M^㲴Fֆf5 (d=wV.N8tj8|¨v rLIRNI'L2I ⺘PS LK tJ x?EH p+J=ӓ†2R1X>u)(wKR:!B^d$Rlq&.XV3h@s@%k(d@;hQI(I.I&NdI$Sn۪E`TTNS$I$8I:dIJI$NAyJ!I Dn;{Q!跕 *Dzb;A:-$R`L?r' $JQ )I&$BI$I$I$JI${rUhQO;|T^x0r# LHn; 1qhӒ:hSI$IJI$N'AJI$ҝ$EJ)NJ$JWuO$)ʂ|q$IbdI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$Iz7E+W=Íʯ9̙pYRF;-CG+Y.h%`ۅan[+qxvR,<*IN4J¶A'Jq WsKZ\(;IܧI4Ý4=ήC}Đ4ҝ̮k'kFK䤔&9=RwC8D왘UNc#a;SJR{'A-6׵i zYa`#S}BI<(U G'JG %qZg;+4?F~Lv:rɭR4H0N"ǒ4'TV@lq 5]ؒqI:=%i I*o{@I0xUc Nmmh$)xO))k>ȦWX2PVkp[Hi Ge"s'CĢ {W$$E82JdV-a5Xd:b}o8IԱ\ I#L`8> U {P-2HY7Xi-{IE\x +..~@$R>I4 Tآ!Z]&<*wkX:ܯz@D<<JBAMlkuېֵ0& -sֵnqT{K@t)D)F׀ֆo_%C-k#q?EݤXLZ,i?6?=$BMIO'y7h1ok&mhIAwM 'I$X\E}<:a3LCAc v}Q!D&ǰxJNsHA։.w0TK/ %,sʱMۺ@i^֛跕mp:FQ9ԦSH67= gRk-{?{Q#qtu )0NYk70(\4:_q&! S7gǩNtm4u,oy(u|;_@[|&IS?c]\@h| =6G4v^5ctI %2h& ?i5ۃ C|*NkCS'I3fֽ+2;mp*,I N3kw㨎N|&/f7s?VZm4=Z<ۑCNzCT7)%4:wv̅T4wI IUŠ"5I6m AO «h F{'O䨁 y$Ip2R|ĵI%DdOb9 ;ID!9hPcvP7tO]SL" \BA!4k3-i q n ORہQMV~:˕" u>(㤥'4~KLHBsXa)g+ې0lcC'ēz_ qy!Êy`VgGaZ$JI$I$II%>I$I$$I$I)I$JK_tUX$(]*j}| YثXlU)l[\6hw6|'rNHp BuMO ݡLTTNZ &%AI;5q, ˉG,,kf֣Iy$};=cӎX#j~heE@dKdDGgS&םrϨչy .^_0|+kL:oR};yS!kf~aW- obF VgP q-2EY)8rkdu@! 3T}=Q}@?PoYd5ڂ2PɳlKEmy*Fvr\LN,PrxUg*@}r_[MǕSCwXȒͧxxW)HB2ri@+4oh++; wU@7@2wU5Wx0%0=A0͵Zo (Z鰕abT `OlpiV˵ClM+po<"ri IaS8V9:e7K NNѸ5{dGdZ@;<m̑.KtCS4IQZcUjpUWqQ 'NwP7@R*)BcE?KRxN0dTG!cHkupj]A#NAs.u?+A*SJf JAgrI&4$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$hv^\WB#}}W`Ԩu&%}Sa0WvXkOXy*iuaꉋq{8Bſ{.=c-sOYI:y+C%&>j`k\x.=ϯ:wвlo`A4LJD7p!=՜ atjd7;G-Mx6i903(nv><(ch`s ߚt2z,y;p_RJD)!%1 MkϬFA/=lq=҄2tPՉx h'-qQZ3w3`tPS8.A1RstCc-& ?/5s5ВxI%$Aк|aG Ky3SSisč񢝰Dt J|{ X(liO5={ ݛ'ZL$p'KCkZ K#O#뾟]$OT,iwʏEcd JNJ`沿3P)} R<8ǺԹ4(& D[?i=>*td5İ߸鵠ӣx{q+klه~@$&\/kEf<9=8ZF>)זv]Rd 9 |uqFp׷uPKA>(th:i:E0N:9!`tf]]c"\lO5 I$Kg5<Vmۡ>kv:ZI3v$KuLPAM?4L[N~e!oKG&͹tnLDr%2hNꛡ:4vcKw_S}\y1PP5~2Q<$)`-xgUSxq4q{<RE6_mYYqD?о+qfoqW­Oq9LLh*A݄=n͍G;5s;I<ԭs$tN9Lk\ZH5yzp֙{8§_hpkZysrLD)4w"{#[96X|Bc~]"G5`4)7ReI -)i}-H(YU |]hcCL>`$8 |&:xje綊Kݵ'ǭ=C{oNt:LJ1(KcCxZOܩCH*4G`*$הTԮ^(黰Ju7THk93%Xu:k=ϻstkf;>Uvc'LǰZ ;ͣh3F`;SUK~IxI:dRGKpi$ F΂4ZopK)x6(!~=d3{ä<wonk6̥ctĀJ!]!{Dw^5 R;QEܞBE()LlBu \}->~Ը@ hJF!6JtEIil|i;HB5O[ &%2D4V >71 d6o`.GM Gd$7cNL oMM-L%Ny!4R3lnۻĠ=!HE -V{BIh-qhV}l}3G睠!םS`ZJbc&0{cn]pOpS?pѶ:Ó=ZO%Pi$O J@) h|n<]{5r+As⼛dZ]cqf `#9zݵWl5YI$RRI$I$I/I%>I$I$$I$I)I$JK_tUX$(]]+bק菂bף菂xVMk8\Fx#Wogq=KK,SzCxR٭G ɒRx ~Ɨ;! ;߲ Tc@MPE&S9qUt?U0K4{C͎0 CĨBrmꧦn-)58Br%(Ou$'G)$RR$EӲP' 1q[MSDh ,1M:k6Sek% HK#YT.b4jCp6H2aP .{G]0}Zc`n'Rc||U{:idee{.04j\TR>Unp jtBC_kSW@SGw2V9KCQ@KkP1!!H:ܧ;!;BV]$-D@p-PW !5l G{k%hY`pRW$x 8uH#'Pd^UGSQEA 7ƪmBa^F2dƪv*3"4e‹G(thRUZBp II-bI$T).‚LUc\ѸDE[nna2DJ+ {*$\TR!euѠ@ NtuՍI$ (w$02:Zڜ_˒L&N'창 TELX0cT)6v{EZݍ$[SA%:inC@9HmA$Sw*I$LR$aZ_!‚HR0D;1сM$׏T4#V]sC|%J0m [N$RihOhq RfH'1ݸD(sԍS (%0hk4:vNI!hI:dڴ/<$" R/`:$ζ}z$4oޖ,{LVw ,n檒0Cdڜ Gtu&ɑ"S0%l 2܇=0 `ׂ逑 [r(b]e4I-R Ί_s?Lʁ$g@ILCSTLuD =+8xy 쇸z*R;iZZ=GhRY ŭm\h$ġJcqw-ЂSh*0K#O+dʭDy"Ƽpj J\I$dI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$Iu?.YkVyŎCRX#!{9^!S02?܏N6xvsnzw47V:xYZp%_AWgP7G*G)5F,q]5ӶwO(ׇ442GٵO2(-PۦDDy@էQ!~|I# wփS $8:!H}4sȓrVC2ʝl$ANI{4^y-CO^{  3$SO|'j#cUZk\#IE[ycR#rw^1=HndwH$M$r-)ksB{y¶h5i? o$mO k[umOPh(ֱަ8P*c;]ڞ $B}E {$ jP{/a3CHC!zᣀuD>J$&Wt{ *[cPhCZ{ԭ{I 1n1e RLNT*ih@˹²Ƹo:kSQ5zG'qfV?J)JD.8W]@6t=uCsMW+W<(tOGUM2Vi Ǘ?Ϫ0Mm&+1{^0!3Gu"hYA+eg]qȀ;)5 X,ڞBIRl,f5]&\BUod6 | a2I@2tFRnw4p(Czma3Yp7F%G9J#J r^ƶe-'hvCes4:J`%( 8*dcZ BmK״pSwScEr1DyF$KC_Hk6 Ѵ&n`DFOdĎ A{;jhw hSz^Nw8?5 7C(>5Us+E:QXbRcR'dm٩G㤂O^x kgVr.](K|^`Ji I$BI$I$II%>I$I$$I$I)I$JL_t9UX$ j}| Z1~ c菂zrlY:,].#X?T •Qb}#FnʾcXT^v+g&vw.dItegCM  к?MoOo;W|W_ {Y+ЂPrJt铨H.I&L"4IJN:fi> rzNFǖ:g z<.S4wܱ3]輅ĬNxs j1iߌvt kaLv+OPja=gyuOdu I$N5I$I2e2JRI$bfYIg*N6MQD FN4v 8HW9DDwDd=`i譎nlic$ .NN*BDv|N c)H&N6hI)$8@ k^ #_un;O)*[P*A$OnE`ie^#KLh<LtHN^_;HΈn3PQDc k&krDyCYqĻsuw6ŭЅԺuh騈*XW@G>iFn"lUQ;'.Ws﨣 )3Kw5ptM$l X5ZnW9?,;f.h@`ܣd@'7Ti0P N4زc2a5Se_\ -4CGKrq vKx+U4hy9n.+|sqμǚV O Κt N\"R4a$7~خkQ1߷A>ּt1Uv6pѠ&k׺ t9¶:ZƺHlŶ8vL+VA"$rP<Էk sr{k|OESOlI2;N0{UҨƐˏ$-"ܧW a-G-48Nm{sZnygjS*j>K4jbJPrdRѸl=@1;L#]@N.3;aX#h_&S5z:Q!LD>ИZ·xn`wl(:2 򛒜H TQ:m5j u pOn).$8\j~[HS"Sn JZ>%?iv$N~VGP%H1ZNo@2[bvu-Vh; w,~yξJp.'HrpM) 1ү6c[cƾJ&  bIӺ[Z['t4"=TP (}>h{5ܷ[.,p`)'PujS(Cɞ{XƑZcpyWՠ覙@ްH&\ֈ?c|gշh1ଏCwT*&1M2 +bɗ顁ۉ2JJ;'B҆H7^ӗ= 6Op%>0ɽIJ©L\ !2uDZ^%>eKS?oH[H 2B5ƪÁI:!?wSM^F©\@0]uRDpIZv"dHG~)XCVaιin5`X<:Kj>L<#JS"CXP@С\ ^ù}{a|TO<'HiVkCCZ;UYt>E+2+-- t'$TIx>i_`D@ mkj vi-Ԉ0E͞TC~%H{t.5>MC $B=.sǻRhsD B~#;Wwzqs`4/S}0> GLc*wMS!o Z^xXxcwjO IzI$M"I$I$I$I$$KI%>I$I$$I$I)I$JJ1_UX$ MB]h*,9yYXWtch:-8Afu¬A;\gD-@7FH$V:^)k ح1% "aĕUf9@6pKN+fʸ U#DDŽGALN(N:d rQRI%I,pp'wJI 9 4NlkEsyo.>QYY?;Slpp3'姞@44\?7B': I$ORI$3̠$J)Ɖ8I*I$sGeRU< +@ө֞O'F?B6EJwͷsv3\5UL((SjdS[]k-2(I$d2t{@&s &JRF!ЬY>'ĭ#VYU'Jr)5ð%V5/5;D oF-w[Ϊn HU`ml-@ 4qʾhK\!0Bm$a>,#{α!k .U52Tql' ¯dPFױufh' ЩnU5ddv*~N?a{Up)>ԯuZ3nDȽ3{CVۘҖx-37;+#@'ݠVY[!-6;*{QuG"81e\e=6*X8l0I姲-oS4^[7& EbK=VX8(>n[T.Mo$ koJ)ZUyuά!, sVnBkW(x\ԯtwMu深huOq$Qr&x] w;`y ]Kyc q}oO ]Ip4^79УhnɹY+X i̠#bc&4k<(S 2'ʅh~Gb]fJTp>(Z.=nMf6,ymC٘ffT95gGuT.W'۶X*Ha{ta!Uc ։%Y8Mf<4)tklxA*ddx`%@nlq*yc.[4DY8y" ԫ~w,$l)P 8Ulkܪc:9'9Zc{l`v1 yU&_d!C1<̦=D* ixἧaJ>&X(ڙͯ}v}'JƝ6Dtj]/;Ze90k X!&a@\Br%.%8ѓ{ǵAӇ`qfZDcUni Lϖ4%qp|xJZ:5pZ8XSdܗ{J[' TJh&!05`x*neΚ΃>5bt1hGT뮰0>: .#Tn<πP0l"E UG5cM>KǘOCk\N$!R۬(Rֲֺ:5\ݍt*n֝jKѮ Bm楶H)T~ߢ"I,=HeӉ Őgwo 5SP*_llcTN^L,cu KD([ba:駜.uĺvʶnWwQHJo' ƚJbd Ēk(!R$&۷{)8Ki=UtF #!ob4W:}3Q8^4o> D= Tl^nE׹Ӻ@)>惻 t8 $l)O*QWwRO&ʹIx#%$ 4[<(qK)LII m* H&2-"t{RWhJ$Nh{ I$I$$I$I)I$JK_UX$ MB]⿀>9ܣ L TmQ8.TCSz-4"((;9QpIJR `(I&NTJQ(t)ƒR);Q))E8$x)QiÐsĩ#(cmbL@ Ө鎉RI$<{SJRd(NI8$L$I~:Tʛ Eܢ H=p -dНhjI'I2+Ynr+ c%jY)LOd 6;qQwC(N:J>~ U}wARGUI$)"IYϵ#h t%5u/׈I$YCk{g jqSIk([cf(+TxAǽ;s~a 2TԽײ&Qr1{6;| *J۫ǻl'R&juaۋTj5 nGm\ǖk|JkkݸZB VBd.YEkK]RIheUe0&HU2}C*hbQuw͟DX-2 :Jƥ[`%}e~ZIUJ4C%蚊={t1 okX_Ķ^k\x$M|ʍDQ2X_[5$"$}q{yemijIRPCkSi%e$\L]$Պ'IE5UFA2U$R ijG{͖ @VVx8q>3cIUJFCZik<$uiТ? qIUQ HJ*Yp(3/n Qm}#Ag%T&RJl<SE}&j߂?BL$*pE;$Ixgi}pB1Z T +1KP~pxhBp![WU0$p)kp$D`St~EVkx1)0L+tS[0{?K?VP6hvγ%^{8ܫ ‹XwBK5 Rsv1'(x^<0ӡUݿ5Y1afd%I0DLx"f{?5 m! }Ն lk΍ *}C kw*y̿9,c _Uede$I:I$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$Ic[&JRI&[Si/ p{&p#+=r·[أQecd8*m̹|>>I5R T-ǫ!uUv{O楕7C%>RuZYX5R $iz:G=e% kAw 5n!Q-RkI)BnY,+u$s>+)<ͮbH% " 㐛׬8'!saմ8=n=l!Ѭ%HCE3vaŨ;=J+i68oqyBnlqdWHp~ m)[Z~Xnz&˫kAc;:[k2I toMu%<% ;[%aTk$[(n:VOԒ &ѿۤgU4Qܥjw [YH HELn"̘hRN)Toq #U`_cZ8n8{w})d6SvvJcƉ]ϥ]t#Yi8 {)ƪ&ѽ1JR4JZXS~44N7dke`d\ dc((q*ʛ`i.۬Tn}/A"#sZu)IL)ZMy5V=HO^Fw[+JWY9Ldr΃3Y, ѩJ{dco;'}#9| !` Сe,>˼: d!;_Fe'\$sBp GT`E^?R /5*Kl8R ˘xs 4KpPe;VCe6FljQk :VVj |X@Ce~pRvI"%jB/kC[9MmwpI*m pHS]2 &HN p;&ڍSZKNˀɔ7b߱^} $D '%eT_u2 k<-nVƒ>&@<c`@ԩ*X<}lh:Se`7Nv`N]*1 O<%e QOHz="}ǎɺ~'CխH>$ѪAB: i{a8㦨ϻk7:wQS\)Q(YJ6&J#^DHP97~E=ÄD h}ۄkguo? UX6Î  DJD(Jb jrFcӘQ8DF%C ljLA%߮h C XSv=Mo4AMuQڃ7J*d'u%uDL4d$}-xFo\込 8hή qZ9>b.Om[NI$I$$I$I)I$JM_c"ʒw?5]؉ őıwELd?X Ƌ6nq)* `Z8lJϬZ7c@Q%@’tD$ TʁI LDT铦)79M*]1I$GWx;$&))tI: A)2tI:*RI$8DIDr$$IƧEa yCu<*R:I=JO) RI$袤[ܤ"Ln-.x*c3DnЬl{T,YRkw8 9A:tO@-'FS}2 H`nN^b<}ݥ/D)LNt<ƘdDVX ! )\F;%]q;.LiQ@IG;L]xw#%%q(l8H6Ncmimh1k"Z(fKWG) A> od5&> XA3csA Jidk$O< 0ô(ɝD@{8XىN &4V$EKI$I)I$$I%,t)IJI$N$I:I$I$I$BI$I$I$IJI$$I:I$I'I2tI:INI8QR %b)t _(Y?ͻRREI$I1I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$լvg2 [_Qf&d5]C Pa!M #V]:K5UI07-?$YYwtOcMVenHL䀚SPC^̒qNe0Fw(Ii>;+?q1'ܛq<$tO jIǺJqJofAp .LI<$B' Uꪧ̀ ; 6p |B@wI;a}5M(Jn84x:wY<;@=n43tD(Jnm CMֱ<ʾzd7y4fqCo'$Uip ܠvkgE89WLKiM̌ Hd~yUd`|;"'X}-Bmt*Sbc}Ǹ򕫳[H;ր u/}:dT(St:vuޝfn'T` H;H"N&IRYf@:qQ`ԪY7aO[ĔM }xbZ\`tKF%s&e4'I*RQĹ:3> tÈa߻D%II,77&u@PZ-i$AM^otN>%Vƍ}Dzr> I1kS'Sv(RFLú {\ft1).Exƞ?Je@CH0jP=ҥ'0ltOLd=aǀTt\L  ^ N:A SeWy1*F7i*A?YV;xH蟔%']?Uۡ-"y RM~RILA q[HX+fֈ >nuQ-ܟj~J٪A8|3$D4C$4 OnJN"yۀwPHO<):!V!β_Gs߽H[Ēⅱ=5:evRMxvy(Kn)Tt]692ˆ@; 5DE34Jm~G y9"*Y%Nc3m xBp$*یԔ+5 qN()Jm@`PKݠjGN\`5uȎ#v.iA2A%:\% lt>!KZ[@LmIĪBkeIi$ E:T I?D^@$@`3ʫMw@-9@C۾|iBhRL)닏uR 9>^@p&Jd>1F֗JM>ґ>*ipLRK]Rۥ7JyꡡaMaEk%wpO)3w[Y'7x?zuN&T6˼N*Sm֚{꘸q! qֽ-cu:\$Ϸd~( jJ Jfē&uQ#D9N&L]#LZ,!%l= Q:)biV.{'/*> N^t]A PcFmHȍ!į 8C?{xxW,ƃS:JIˋI*e:}B{h,N I$S1$I$IJI$I$RI%I%>I$I$$I$I)I$JNXPUծ* L4.WjNإ(fG$@S!s*w*"%ƪ!hcrT JS'N ))Ie 2P铅)RH'I&LxBv'L)ʊyIJI$56RR$:$I$$Pw))I&N)DǣxsZ^dT/~ܩ%rPJI$8 *A)$NL $JRI$dRӾ{ 0j}@uR7{RD2k&4A$`yLr$KѢpi(I"TAY$IBPRF|G %"Ha#NTLkʊe6g2N%2IE"8QwtCZtuQxDs%$I@Iq "CvΒ@'T% vNdCLCj f=S4q蜗|SFJExטILC };!:IdtӔDI$$$RI$NI$2p:dH( LTJt,(W6I*Rg!EI$I1I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$ʍx]/<_[?thЙ\0_rJa>JhoZmx*3 W4M8nj UK7ndC@3z%:`i^0\}@{:YnS9Ls̙LSI$Z?;˝cj#f@ )h8~I$Pŕ6_0O;LYqWƛHI:dRF>VϰƠ]iev y)CsI$W0}y=: 0ӡ Ǩ )Cj NZ@ѧeu" 1?Hkm$&(NJfMLЉq<;r;}F|#Ĩ;t'R]d$]tI<&U {O0F>L$I%1e7Hn-IBXt1\ƙ I$S99 w+140Ɲ"#F ZdA"I$JJ+k[A&{":<g=R@;x)) d$G6|ҢH悒P"O. -t 4/m:{"G!$rI)tI (;`4Iͻv*mKO(y!ʈv'I6,Y\<,k iII$TʴiT =HM/֘0Hۯ)1HuNYc4ؐIqBO+Ϛr$); 䞗auO) RI#uEA<$gvLFgR qR$x5שrA5';;ƘtIR֗8I$I$$I$I)I$HnEgA X$(%y)($ MIfW@SVƒ tqA<٤@V E&-FQk$Ө)=Mߦ xڠ5(*)Hw?l4):I$IRI:dIJd$$A2I$I$9L2tI)$I$IJ $I$JRI$I$I&N$I:I$I$I$$tI%,I'I*O%$$BI$$$&NtI%,tH$I$)INpT$+w(_QRg+I$cNI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I.X.π\^X{ʭ͚&\?:_Y}` Ъi1#`"7/=퀞\:$Z8#UuvWdGSIj ?GIa28Up ]3(N$"l ,#Sٸ4Q:V8i#RS% III-;wc w*Ǎ2N|JI$ݧDEaQQXH$OgaSI$JNuӡ j>K&t{Z^tq$S H\Xkd4*Zu?0HTKОI%)R6Z:L'@iv}P'I2R-;t$nrpύv{#;|]"X2Z&I&&-,r,mMSF܏n%$II<1qq%:E6Pm~GZO*zP\ :xR)8o  m9;(Bo^ G?r7K,k}ύ$I4(Z+ 6X n:#RA!?&a9IL\R8 B>ȁv_HMv:LNyL)HǍ#[m>lڧ(ÒLIQzkI<&%-XR'6_6fsMUWqEg>z@;|}Fn A^vn @U߽IƫDv ?TRdG%<% i(SScx_N̆I!8n!JFF- ֘)P蔣yvxLn9>esOݏw&8h 04OGwAҕS^܂ n>!MݎAݻ`t,bu]vodIw襹 CVA\a=E|MibN:s_cIG6Hv ! nBP]u,f6<`47+Y4ZzCD|Sn(yR&ڔݬ)w!"}{#[T-n= '& JmR$4})v2d譲ڷ:Lf@2 }/(2oRaTZl@D_44k*ú;ls`C'I\@tJ!<&ܘ =f4KѧZ#= pEҒ~qSZ-h5·l;a[oA~v/ S1죾> w)XU4M!8,rC2JMItQ~\u}L hגt$DS̆\ti?sD *zyi`#o`7R qs_ۺv ˺}f'Li(%xN@'TVOUvdN:)!*uPw\AT帿@;51'fsqf N B✹ HoTep]ߺSF c;Wx)D?N_ !ⱩO8ce\Pw|@&)h uLlv7ʷVt[ zv]f%<$9>GC~>.,9f!%!WfeR R0Yeo~J܆Lh;cY[ >G /ߣ Oh8 %-mHPvDĕZ{\q1 #UAlݩsD) AVmnN%;eW6

I$I$$I$I)I$H_ϳX$(.=&e/Wx?I)IX$1iipL!ڍBI.TmէVRg!2v(DAI&4&NI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I'kKI)UKpe`ǰ^&qԿèd\w6#fs| ㎣x + 2G)u IctX~bCժ$Y@eNv*阵C݂9Tp`Vn/l릲1~SmS픬F6ǒc@0Ҁ"G`SMOOAޓ? NBZus4)-da#<V@ZOQͯ<8I:(\W$䃑Skl0j?zу I{, F:)$%\0fQ+ vl ;xfSLHG$%4!0䱖;ӠkT*s)+_%*;d)$9N$ef;XӮ+5Ohp0GEL}D9:I$Ө0ķq;u) s'PI1O ҥ&hhs5nhp$ E'fnkD?"Pjd).nwըT_]VY$,g 7io?9i0481GI3)piTE@sjkaIYZwy ,%9C< t,#P{'s]S! =0BINJ\%JI "ƐJ2l@u-n m͟DJP*5]'E]_wKFgj65O UE9&I :$h֎SNF6ʰ8rRU8\7NxftusNm ФoFBx B*p$E֏oiYmqKm Kg@OeME8 ֳ$N';" h Y j>%d:|TD%Jn5<PZ'eәcR"Μ(4D1-!Vt $l=7M{UUlShl6'"~ C䟎۫m.qpE`\<?yϰ:84C8i;uTNh[p=H\<͐ Cⲛꋍ4D{J<9"|Tu  -.vgגGiW0^ ,wĨ.z铤I$$I$I)I$I$JRI$I%>I$I$$I$I)I$H3  X$&w:+o)NS?e'W"c'h(NA(BzsaBb+SLpl"tP)!} g1 5R(T7O1qPKdp 3\;`=NjSic w AxiRm J$'HxI&IE5Y z %.RILRIKI$AJI$O)$I% )$$I"V%j;O))IIrMR7;w:)Dt9PhۊZ7 ZP n Hdӣ*~C`(i6Aڔ3&"Bpͮ0BwHXG x$4 jI)$I)tLI$I$LI)I$I$JRI&I$R$I$ RI$I$I$I$$I$I)I$dI%):dI$I$I$I$I $I$I%I$I$%)$I$IJI$Bkw[CS5rR(@@8$!܌\kGc??X;ILZ8s @m}=?9r,}9!($f9ɼz-\[?4'TG0!DUBqK~TP{t t)z mopQMnBIdN!<} W$JdS$N:I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$JHuq*jNU[H)BϢcMEA^@VS\U>{nF BW50DYG]`^ˍljbӉ2\G( vQ6*E:m"VYh0cOy[Z%]u#|ze'(~gE O Q0RP[rnJn%cnùTYk[mo`›ik EHNd X=`( v0s܍ڸD'&`ky(e"u8M QUse.1~ⅅ~ATNC]" 6|uĕ8HUSM) tGTvh79@8yR-M S{#k2'NJvqD'VC4Gn`0"> :|Tbص4{'jg~JY>!&dG0$R8EŮLvGF0w{3N?5FJpS%g uQhlϞV1ŠqTCAKTمN4Rc8I'/kATZe7#T%9 S Mc]2N$e\4tjp#Jm9lh# ha oGt쵃QO3xJ6]E'QmlfoYϓd oN\ap"yJ'T J膑1)6 /7=MӼ(rdiʔ&R6XO`V9c6 1|Opnw1kyJTTŠn [O-:0rJ  g68''J¶4zDDh9/ݎc^%Vi,sNDB_(Y^&-n LBNXsLDK)nR&dwL6綩U2K2G*hx`9QOȔ{6SZH`(nh~dwU٠h#C|:BRZ\%V coc\`q([2N"{Bԃ\%V='htƉ[CZNVU}D q]4OV!uzL)d Ta tG< Q[@.;(ƒ5Lnqf4 ,4%kFW#ĨLTQv)-$ܨ\4;@"<IScw 3puJ|``cSv|{w%0FOÕ4sdN;x2[:j s|Vqk`A&R( rw$!՗em[m`5]0HD016RqCn1ʿ([>+IDs[{CJq TG \2`mqxAVHtUAP'H $2dVz"+o qV].y铨I$I$)$I$IJI$I$RI%I%>I$I$$I$I)I$H3 X$&w:gpTʍ-[8}'PApg B~D=h0Q:"eA4I ӄڢ⤢⒗NpC+x,uVhSZC 0HWЋG opIۣfAVd(m=vL(QMd9B8P @ʁ5PR%M(N)I$<% )tI2tpI&JR%$I6|PyS:0TSktTb=@Q [{*9χNC}g%6M–,}ոYd /c6h9ܕ6[~nU35sGcu3s~I%%vEDywP?za2 K2$Uni5I$35-DS);ɒI$TI$I%)$LI$$I%.$$I)I$A$()I$I$*RI$I$I$:H)I$dI%.I'I$J$I$HRI$I$tI$R$I$ RI$I'I*I$AX/q-3Vi(8$ yF"D!ysl:uPa/ _~Edy RmwC+1/G}+*6#vË8x;(2?lqsKuBS]<SX17\ N{CH:+pH * IEG0yMKZ<(5Di k!D B8.Ӊ h{v)]sNӬX|nr!!TZ,&TxCm"S:>#̨YĨ2tI$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$qַĄ%o0?.7RcN %{oB Q1K;q묮o!"Z9Tf籌f|k07j1piߜdvJֶDz3|V6eqUsX$qF"O<0 }9H."@=jU5uO!"BԈMJq:m67FHff /D*Z%(b!+U9"KkIJLdz{Xk a'H:Gq7Spb0c$j+x6xL-͢2P-6H|T$%4齶ohEk ρR\4hdjApӔ4IZt[[IihgH ]g3V[Y6h'<`⤔BV5Fs<975Dn?۞ ')Sk-ԉhI:dSX`;}۬&U25J}& 0d/ș(RA-/tx.>V=GW49Cm? L')q l<ƶXוmmkGJ:}NdZ-ϭAV!I3߷Z66PL 9eXi%;[ZuE<6|s> Ӧ MwM@(%`9_$ *6[c7FKDR%c z>HhH QfH?)JJ5s;Cs=ȟhH=QkaO!42VR׏N+bȀu?V~`9xpH@O)YU4+2 @Ủjٖ i_&nDKSИR5&Ms |k 6by$\\e& vR%4"R! *jӏ{80Y%xVql= NОBN2b)aSoc@ v}CA,k\Z yEFӖ L!&]Nȅ0qaOHH*1)̥jk6גOu rw5 n-Biħ)Kr6֦Ѻ tEkt~TF:\@[[OzLRaM+"NJnӱ(w 2%_ 2t)n6Ƽ6vpHseZ4.Д$<ҔRSS\\ ՞Z}@7@tNޞ&gQԶ 4AI[e&v`uM65ȟ )G5ĐLɡ(NJR:M ei:wU||gT,C缀iʉ '%4ꆉmW7G$)iM`v:VWVZ㸘Sc)'BxM\)i)!JN\*'Hմj.I?)%"eޝ  pv>>I{ u>)AI,hki:I֐'U0 Hj#a 1. ?!iJmX7D|RmsOmtGX!C^ je \k,HsqIV0lphP<Ih nƲ-7X.$"4LG=I$JRI$I$I$I$$KI%>I$I$$I$I)I$Hγ ŬIJLxNhRo)2ِ8B% hM(PPvuCrJf(0T $" ;S9$.Y*R)zwihaT҉Nk>^ `9A})֪bZV”%h'TbP Y'L*nEs$IO $aO)RDJmrRkØB5*S$d)4&NR$@(|6Z({Rit犚HYkaaSke[+R7%LsaU}ܛДxηچD+MյPh5 iԹB}V8KO rf$^~6x(,y#u4S W]K,17X1@+'i[Uޭb0-r2^ۛ+/~SՈGg *:)#N%'I$I$I$$I)RI$$JRtI$RI$I$I$I)$I$$$I'LI$I$I$$%,I'JS$tI)II$IJI$I JRI$I'A*I$'I$I:I$I$tI% RɊtL=ùL)< ;GIN.VPSTcN2tI$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$lc0|I!I$%ej0IyX?VAn'NsyELCɐ4eec~:[Hm6k;IBuT) /T4hS=). kM{Zg@tUZ9>3'L(dǝyL2~j4<<$IR#,4N WsL\DB-ti@:>&NJ`9MNZi"u\7X6wН:%fL>V@ed$g0n9wM4weB!>!JS ꡳ0j24=kѤ=cwI.S4#kL|T˦HgU2XZK\x옄)McyiyBQl> p$GRI$SeHd8\ T75č5#$I s L<\K^0Hczaۥʓlt%$:IR>NԮwCS֑6I0kiqi$ĄВtЊې%ԃIhjacl7I>1`X=I$STګ Fh BǸI0'Iᶸm$ iNSn l8%Xck bU[K 5ֹ$0$&K~S4Jj[ƀjdFٶh ET?}1KIR%DSZ vjR>ƍ sNnRH]xL\vLs{αmmL$T F{&?Ȱm3\G ah:4ɩ4Fh&}$ISS4x5J'B\8N!_5;kkx]Td'"oHNU.%ťqhgѳfUo $5K$T6 Gn^Ck&$Gk /wm?k2OꤒRrGa  6GQPcv(;E$pRV+!mJ /vhgZג֙GSc.{64H}[\~--n<V] 9*07rcI,w  #OA?9\I#A$5{"9Nuqԣ[ ;q*4Z8Qk\6IF|I)(y ӡGL5J%8O*Rklm1!4 tJ] Ws#0hJc|Us^QОeVǰ{Ў [TJQ'I)G}%@t{^]! ,^Ӭ^gQ GpTS`Û捋-sJ-P0{/ fYfrUN6sH"S菂I$HRI$I$I$I$$KI%>I$I$$I$I)I$Hγ BJRb1wMFSRxe q]&7хB% TeF|p BO-h"JYd&NO`TLBJ\)ʃ\$4E d:TPR`B`H$J.*2t袜I&JRI%)$I$I$BI$$IJI$N')I$_.t rz}W9Fu0//(9 ZfkoSʟLonĪ/ C8`]Mfa[k s')kWM< ԮaُY}}{ZM%մi 'E_HC^=ÂI! XQSzI$(]$I2t)I$I$JRI$$IJN$I$I$I$I$I$$I$I)I$IAJI$I:I)tLI$TI$I$$I$I!I$I$JRI$I$I$tJI$ ')II$IJHt铤&NJAE8IK&NI"bVN' u(h_ο 4$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$9I$I{/C .I1[Y. XxrͿqUW7Ԫ!v I>2P$QH:1(T s7L ˚ZLDkѫ9@H=ۤ$I!NgKd'/ȁX;7:\cDI$ڮA3! .!0X" 4?IR)Kb63Mh0'R$KTBI$cV[SӹI;$I%1c D>p @*bD> Bs߸q$I%)n@ktQkđ.q$$ZqN3ku|X{[V-p4I$@a7 α}hH`YJkN@IGtR4@ TwM v;,$vk3Ѻ2I$ Pr-!DC_sZΓt)p.ZoiԴ'`c[qS<W=I$J_sDk%;*v[ND̆qk\{kI$  npH .6F肐[ܝ2tS1l7hĝP*fI"4G oI$JLrT\{J㦐C5t@I$S*2%  HSUP6t?OQht$<${]Vxח{*YcƼ5'J9Rq&<铄ڪd;@ qxyR/!k 14K sDɒ)S %ǻU-&Liv l cUckCuha9"TV,=@h0)sx)b]`!4$%PKaO؎TXL*-! Il=$'$Pޡ|wc׹>t"> @ԁ?Juhll&:\$6 @@0 <Lܖ6YT\=kɁ?LNxH)#pqqk'@TC |KZ۞3ిx 'M:Je`xlnƊ5YKUѷ$"LԢî5Lc!M(Nu $hRZ;(d"uBkKt"hs6DHm.=+M\LCן*LB%e:Z8bK'hoGٺWfu#wq'Ħ]+^铤I$$I$I)I$I$JRI$I%>I$I$$I$I)I$Hηԫ0|R*6SV4ŃwB?PWm1zNKaPtFjqul }ciVyQ+QW|J ܴ!aT]P`ӥJ_sL JeߪV^>fOa\#}~~U,S1\*}NMS%W yşFj`2P_3OecÓ~\SAwд=?ĥhN';Q| ]Ac> =&KDgn>GEy أ"?K+DxZě쟊uMǀ~]/U4|3G}{\/rBˇ޼;]]kϏI^S;;SoNw-{>ԸʸC} 7J+ȷƳ^\(46L<-C_};et^~KʃI3ߩ7ljɳ]ЗO}E;qSܡ)4q: w\ ԟBEqSb(vaEB;h>Z6s)5V}Mk5܈>'?rAKj>W}?tmB9k'$ҹPgw!Br趧<%I\!3-7Pw Y'̮^T:W:>N>cA ^仫=YS~*'ee$ǶgOs7,az(Kܗt?'4r%6qOq[RI'_(/ol%_~>Oq!'t!`?UqG}|{U=8N}1sլKK`hi\/owW 7bk>&\؂}ˍcIowޟhx[ ._.~mqQo$r NOlƜ,;Q߼tQ(Kܗupkvi1?^g:޸ vQ5;~?g;L~]R㒸C7e#6Qp~!I:y.shPGrOgt$Z.uFH?0#-1)4s_FM4j.5"KܒCp:ϼwjZ~epyDk˖?TQ-H~l1dvK*;@u-A1?DW 3›-rCQ&4]V> {W{q[ޟL6Ny1):uО&~M4.͔!q)]#115; Zu:lvUɟ7~Pw;jKgDŚUDo<"`a,p]@?$t]c~}Ў<~iגWlP*:K57.%1]3/ K5K ~"Gx^["XHK!r=[_N%ożiBu}vffn+$:)$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$o\LWs'+0A<x\ApyPd@c\o#P[9#@pqwaQh#-, /$n:G9ɲJײ4Zj-H "~)S:(IH`@OBv;7xkvIr{ eRS ڐ$'Tai %@XhI-=NJyI2xJԁQ\WkǚzAgn:k#qwp!$JS p ѳӯuEiWy-5DҞSj.pm@LΘDA*C5'MQﵢe9r[ZΞ{VM'+$%i\B%x<'H(h2\DA {Y'Aߔ򔨧Bf3͗4?l&9i ߏ 9KD)Jrhr~Cw:A'=^I|=Nv&OBm;4gSiM)S]/{v˽ߥ@{qq!j>G0t Ҕ%jsIow$kvaлZkv֙ik,RtYJ'l4Ӝf4PĒ߲]FH5Kg$iHJmkNhD}ݻX}AUX63d𔐇ǺO0H >M  \62pc%RM0rR{CKg'r-;p{Xgvwc}7b5'{"FX<๽C9줙4:aTʃFLj]i-` q5Z pju{;I:ba6CE-^ƴ>O'*,9w'd6l;3݂n hA'T&.JR)e- c;!'m w-'pI6%aM<[$JuX'{&'^gۺ^|Qe6e kP DОy𭿦Ktj猪` j’GS Otۑt4hk+uBc/.-I10L< <%ClGn3!" ڜӬAUmU8l$SLhuo-dû!α ?Ic,N(}R`!!p'O4?Shwve%ޛ`>5y<'TFO Zً{!ɞL600#2>`HPȪȇnqp8NÁ sKkI;>HV^[π_{ݽΓ;Nm.-8I:pB@Sbt4]yUZ(ȮyMkHr)H)h~&'~3[=*`;I9\tS!}Ceoi'8<$ 2KK@w[d0sK `MVNh%RO )$0htY3?Hj;ŠNnc'NSFRLDX&SKZ4֐c56 츯 ̝]]^Y2W9(qeTd5o%ݻ-Γ\w1-r=$[E$I$IJI$I$RI$I$II%>I$I$$I$=8u9($98H蒓z][{J*.LA7S=4襵1 )$O:?POyMA $[LBBǔbOM pBJg*N#vD>C5rP9k^ۧGNR'qNGt! !ۆ1>AdI/4T L}w SO$h)Z"nR$v ;#n P%%4LZKƚhSK1 %2- &LD "@Nז{[ S)⒙OˋKS#ۣ9NDIIXswԛ3tA1> FSJb :7A jF$ dJTcuO;5Dhy(AJ5H0@HOO&:x$q!2T@IJ\v!Ȏ@kQJH)Ӕ-r`R - y os & \$ipc&"Rh ٠NS8B{P9X-" =F9|QU8FD'3n\5lո 7U]zXǸd ?|TЕ8{>"\v $/$rR9x̽s $I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$]o,0z=e|[` 9yblvpo?6N OQ I ̪*sxbhsPkKGYъ?RaC b#̺_cC%@[PN S%)CD\Z$|N tj閍i41:f~Ir $)IC7X8"+_ޛvuUr{e9U1m㍢\GdXChhҒmҗdf=4A-4v׽Ŗ~TyO2km\ HJ%.R -v[H5󿴥]~;Z[i4?޳0[JRI)47p2k*-ev49M%\7x;NTCH꒖ȼgPPdE=J2\>> I)-|T][a/YfD {J&tK.RSNBp}s.$DyPf5T44R &ILHvtݤ5A1$@]tNR7Yc :Lxi:|m `S!I$ o $q#Y '@uQq1ByL%l :n9QsFT=嬒D;sn(I$6j+$ U/sC `; \)ըZ; $S~kk kN<) @ wATv\5,DLaYTɀRHN㠞wڍ;Ic<8T^@<\I҄iM6C^Gn;,x;XqUkkt s1M TK~:}mgkO0J\#ᦿG˲C&1&)Mt{%=YmcטU;3 ?+Q[k*Q asvD dn,fYh=^t^DDR*Sm{A."ft:l<ܨۗ]C#]hdƒF;N ^kaS<{ʎ^N6 u5lk$>R(.4rY^kt/R-JHSi V!ǏYC8 hc%4% .[}4 K.KתkG2U x&tY960K cb#(M)\mxV\,l;Ϸz{I?vu(J5Oa>M`W{Q=@u DQq(_o[Υ-ɡ(njoFC(c sdn*˯a2gH\ "<'mG@izwV'hjc;OF.@h;\]F-2eMc6^39YŮ--ĜYEzo -ʜ\A:꺜 *s$iRI$I$I$I%)$I$IJI$I%>I$I$$I.^cH.C~w] Թ?WXqϝX\V y"1T[Tfr.*7!Ķ;:FT@5+<([Iq%DiR3M:$cP{G>i;y$Ve%NR  JBxNLL2Iw:y ʌy?zMf '|5i۲rtI0> $}5sHߦ"_)E|n))!q;v@?IM4Ɯ$2L&xI 8 b sABSrF]{XAH)%轢BO #m?2JbTyJcc;O!G)D;:JkiAƚUt 7DJVk.Jmd\>2I%ds ;@+.2$n WSy* 3 IyYȣO58pSy.ߚbVI$HRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I/Yy  W%{Np1 O1kF|T:;H mai`%AP C9+/'f+/i:U_3QѭZRC^L$It,Kt(RQhJAMmd1Ԫ{Z\f_aրyUM aw%)&I+R D*ρV( t̔MmBtISBd 1Lq$Oa*۪jq I !$9O{d2H +vCJI &J9h>HRޠa4mp*Mq%2Hڜg] LsF[\;yHB`O)$Z dXCXm<GVΩ4˝OWѸ;7B5q> 0 tӲmgK$!.`\8R/%IɛS,q?6R $X Y:v9=_.^HZ&#EL-C}7 IJV;+Vk5ky ϒ5 iqs%!AUȎl GNZ2٬H2˖~ ƭ9.?f[}CZ^m+926W[k2J=t0I#9E8c3Gt Gt$+cixB_+o`el@iipqBuӬ'm $ӣ#[ײɮ[-c4Gs:Jf<4NX EO)z{!_lƿvO+׿nu KVf N@a ҞR5E>A5XMhe0UX 1NԶRSN[a0D] ?5lG.=~ͬ)q5O)yN79%ׅW24 gI^eCA<Y RU}gƽMŝ}hkD.SfVtq)(JIFiInm4C|k22 !׌7cXv5NRN)XSFZ%+V[c[cqo`PL5lT1jRiN-=q u4W^;ѳa%ZIhuc0zd{5׺Ŭđ &D6}I+ rckAXv}Z k @Zhc, #OyJ@I$/.UYux2gPϵ6h1qqׅ= 7S>)@JI9o6"!Z9v tj%=%[ª('M $ ANM7TuL7v`]/;p-h hh#`O?)Լ1E\to .-2ԈRKB۳yٮt۽8Er Se#lT@JDTk uuvp&{6J55]Bm[:mZ\cS }v X$h[x[X{ LD$t[qs;]:ֳf:$Œ&*I<PK_Xo^W&nѤxH2f;&(O? 귳oVH \Ia\$h4O<) &cD :&W;Lڭ n68k4&SJi:Cc^[|Jli . xUtvOO BmnJ?zmwil)76@_eie3z=n' m-ɃO,uBVf2DТ[O~= {G}@PuN-;3Ì-oV}6DB{" `XnEg.۫vhi67/Tc|K3ಫ6<Wr۲״i:!.ztI$I$I%)$I$IJI$I%>I$I$$I.\c*D|B׫}L)|7RmWP\~ ;Wrcdg4pցn[lc |Q+.PPv}΁  ##o`屢fe/4%%7;NO#VhݱD$tSӲCN2%5̰L*άrOcXƪn蘻]< a.zqgc` ۺM4[=v⒓Z$ ps4Rc;Y'oH$%$:II3x ZߔI mTbȍ~jAהũA5MEIēŭ ><Q)'$u(eD?za TTZ$Bgh`LKGF%7:%"9HF(j2 |R@NP6GJxs rtQ%"%&kݩg0PZS_Ir)8jJL7Di@$a38*J} lASۜglU5Jw<D%tRΙ!&nTuMΪQ)lݴP@\e8ӕ-IM?w &Sm%$dH*؂uRD uPBr;)mKoJN}sLgǺn-1)ۓ(h-Z_SGO!ls!@rOy:8hr]˘.E5JIOobIIAJS[9*Pr8N)3=ÃD0| Dh(D {TQS_K-h!%)4@&ѡrkƎ&Q)Qg#V"l0ko}Rugk +uy@°9z.6K2mY$NX$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$| Mm01LgxEl\Е#ddqmd#^k;O&ͤd.@O[N'/*Yb ^K8!:bZ<Dt*iS6O!ߐ6xLxI%3Nj[Aid]k`#q<I$XL/{]|Sf @I$T՟LGGt w2|%Ώih?:JcC\O Q|jIh#MO0KxI$4 RkXw>*wj=pSZIL4urJ# $h>)o #q)$H)gv֍4OӐ@J+X"%8)<&IL0-:T^_o›I`$I)n7NT}!N;[ jwݓSV;`ks@jwZk>)h2 Bt&IKVDA'WS RmҰ#qx'$jXnIpM[Ezʓ_?0$oyQMΈZiG>^Y\杍6 BQ #j>\lC1Az>Ѭō @:p)IJ1̑ ipӲѷӼ;78JmRmC<F]д 1jy'X^X5JRZZ&cE7`XHhkǚ@kdO)JNXCfG77Ra0I]6x& { :n++:Ч'M*IV0umdnmisdW5,iOԎG䤒I$WQL?Hյ{=Uv`VowA:)LԼCu uUZ~O~S`-'U0I$85Gt{"cҊ\gx<sZ L4$bƀaG} ;pixsDk&A-#I$h?Jig==NIw*qaG  %)&GN3\5#B?$ #nx^S}`'.$8asZ u3yqLIKN A )LgMq*8b<;q]t=Q*E1M) (4Z*nuYIΡhc%&JRI5)l1 uE-!4vHsOg4PRRL{Z+X iqQ;rJoNuH6JK `cm♬h;yM 'U$%DDξA< Ё 30$B3Tm&48) -h|T!A8 þ$]oǠW?9]6qcC []䊪tnm$IHI$I$JRI$I$I/I%>I$I$$I$aT} j\"ddU}p9=J|Dxjmt'D:)*"kS##Bàޯ|AN H 5,Kt=O~Ωi,v%hBt쟺@})pf9pDu'>úZTA*/q$6;S^O!F% $} zq8mqT)%ɚ "c(c8 @?)p&Pw/TFbS0q:% jTif8O5AuU#7S)JyM0Jbe7׷*N3l)qQ)R臭x駂EΈM)$DU{ :^bL% D$Lů~*IDCv17cT!$18ѣcd'uuRK# I%Tי8H2\ iPZs@ *OTGѕ`YvN״p)hj%EM_҆DnЃulN1hh4*dHMHAMVaO2FGnوTNjb}Cd5]JMj8 p-/VөN('%$}oPd#はe%/Prp9IḦ́ BgC;hۤAv續x)\>I:)2%AC"eu[`O[e>2s d܂diMɀ qSm"BZTWi?ܠNI {&hQ$' PAL] $I=Ӌt Y?-"e1 -D{ARm6E|Ԟv4MxstJ7 RRw'DÒa'ևD⥿$yL_桼Gl}DKta\:wQf R6>)1(NJISk..miU`4螡~apW5 -KZ4]f\a8JExk]_Ϭ ͓ρ\(1gEOxoLt\>ʪk͡ռhB򬊍:I xe}~PגHwΚm-4!:E4JxEHm8XK|TOt9%Y^^%V57)I(I%6ld9paiG V5'IjI%(.ڋ ٻo`VNUE OCCh:`SuSFz6}xM=Yg߆aJ~ hƓ'I6%b549qw'k6;iNL[FDh :4$T\P)bˬ4na_$L"X=H0*M)@Q />'z;ͺϚ0؆sB͎NNH9$@[deZ4H$)Iʶ:~(A ٴ# |GKDJJb]G>)]>@By#ʉ7'/ :8yCO*qD=Dr \h`^Kg?^~tZyJXZ{-ҭ |xI%mI$I$JRI$I$I/I%>I$I$$I^ҁ=`󵿑xb\ :{ *`<L̐Yx2qh{*h h 3uH(JeBY;\k9N{)T@B b !#hJA|7FQ)iS~(K "IIퟌ$# %)%[O: L Ѩ AH:r;Tc]Ɉp $Х\AƣVjgHmł)A#n-fXy*D&NSP3̅ ` PR";c @:5?FD2AIFa)5)ew >>IJS)NIH`M[wO[hS%$\\Gޣ#k1>)% LuIKW-LZ'L#xLuI)> )D @L#̩A%ڤ$REL+vm)LP'.׀tNl a"OeH#YhӄIItӲNxk)R 'E'Mp꘼J@'|)JG pnӄa<)Xt JjTTs h'i@]m1bH) |fB(N`IrR!$ؐN'G*`v)*0(R5JR_y2u* 1CxID)LLjݽQZ~+7:Kp+3/EϷJ_Yv_޼Xч!"dXd jgb6P+I$I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI${GӚLmxOĀ͏69}ʖU{D7 χd{Jkb"cv3+dfth^x/{s--cFE~۠-% $ȭsmx8MSl|wCt]O@kI(I%2t8AG+^D#T:,[Ș'SĤI$]#[6:{a-[:1xykGڒd.̩>X+IWiphxI9HrQ:k OGP?9 {cN;'I$BI'B8_v?'v; %Fӹݥ4$RImLx!O7?S?sqQm0昃?JR2 c^ ƷC0R %FOCǢngsbuו$JAS=O$cK<-;,iqTI%5}rG";!DiXun'ICkq^II$Td)6ݠάA=dRG:ۜ$y'8T*nͮvF;I s6%eCdx4 ۹ gU]Ak&?4I:JWDxwL^ݍ ?̉-kIѠq>BI$RS`YȀP5A1*@xhf qFTؖ{ L}.0p<[!B` ߝJ'J[L*E\tȆhr̍5GE NZ<1k-F~Ps4ߺk2i&L) _܏?k]SvdžHO*vsSR:pR q́wsB_@u ͌uHHU$HٶTxhzd9u |=zF_A2rMf5k-v+Ƒ¯isOZѹڏI'PRiH1{۵:* {v'-mo `ti0?F';R1O#_4+ JK\<8 f3I@3*F䕊%6U)hL rZ=@$$RFt!F-'=Ѭ;\v?@C'LR&@5ov\zm2FQe;]Q[c G;@&'$6\oSoʷI}$ =ԉ'NSH+4Y<}f"Qw$~M5<@gINH$Utā"xyc]?53Z_s\L'O "q,0nWbxD5;n?JH~i80v5.2eWi5V\]M!LБ RA)FHFjm|r@'rVVƷk&vtɜ@7 7Vq-skuU66Xy*t (O)ҚOazFoulDDں;N$PTdI';"5|S&A?pT#2L;%\#ErG@ &?RR1)C|GeG۪s/ t}&港|A^++@&VeE8؏5c̱qI$I$I$I$I%)$_I%>I$I$$JOVʽGޙjw^O;OfX#;We;wnvYb .%aH (M^׼.}@p:pt 7)RK ,> x DF@[i%2L#Sj1h> %3xrNN%2.HGP d$ӞLA> qtL>I 5L)LO4IN`)!p|;@2d=q 7pF(Q[_t@RgxJtND$$uI+8I02|wƞ 4䘄D !M ʓ^3 N/ $L憎xr8׺r ALBPyI G)R:ZtHI%2  67NOC6h"S I)+]<(;Wr$4wO IM`wMFrm#%(RH0n"#U&?xQ JsdmVhݠH>I N Jy7>~ t{8N@))#t|rdd$b D0C:ktP/ ) LyM BpiHY>pDI*3ӄI2Tv*\4tڍ<*%KJe}l yУΉӍIIqfo%";$Od/4)nh#U5 ˊ[% )fVֶ{=úbhl S:%!DJR1\{oLDӟR!$$1 &FBg"IJS)%Ee&jd`S Hփ( ϒgDӉ%1 Q4LGdj hN6hiRRqQf7IIIO7tΉ)o$T . .S-!F;"9IFd|U`:jBxTIJe}|BA/b0%9Pn|~3Gj?cܩcfӸ=ytl9LZev'g*ne*=|k˿z Aޓ][w I1Hj 6\uB-| QiR̤K>)J`JhTcHkC@A;ӐT4%:I$RSQ:@G&cёñZuXښd{cNgQ % $:vYs@pd4B"KN ?gks'I2I)!qO+,RbB?L+Y>KS6F] k f汛T,պIZAqDBxI%%6[3][#O'd9%w(ė4BPI$d^惒F֙HLIi:vM2y钔ҕ+~HUh:Z"tDGRC-oSI Tŏ\Ct1{DO'S L!iHTl{I۷M\8A)s6xJINL MVKto@L O$E y1. 8U q %'9?I$H?sP4p?|rI$m,?l'(E;GnM. k@ߜ$K]Î4œL?P$2O0V8)pȭg2S}nݭ҄כ~o2$VXdsbR&@-nMxDyy|pI6:-A+nfkyN =ZWTGiFkZo%qbC#a2I$T䴍޴[$bbXxtjBdI5-4lΪ&9N;m̔BI$ Ka \I=w\kH9.OoBbDH>@c79ָB 65v xN5r4%I#:@l"R%(܈Ip @(:< )At|K_buC8p  iS)A#p/qHI1rD~D񛇲\2%zu񛍿<~iWpfQq, oYX<d$Ky뤒I$I)I$I$JRI$I%>I$I$$Jt;kGb;um=/BL6c[=!ՋxVfEW%xV[}[*>)?dq.[ UkNBxp9:}.hx)$J]> J\;8I@:( s<E8L6RC2~IkOt3(>̓CDR2OY/TC8MZ)8L<(w8ʉԈÃ@4)R ))iӺ~DwAQ;xI)HH-yIJLt<&tq82|%)H))N j[Ht$Tȕ&:zh ) c”Ia ; NS&(`HhS}vO"%))mh)ŤG:#DI!抔%1w~NJgN O$?dp>H]ट2pRBJI™A: DA$a\g87 %,-0>i)t:%,=t^G:B"(𒙱$g<Ί1Nde(OR0;HBc&\$8ה "%&Qq&&.$8I1:p'[ {.C&RsI.BmSJiR2$miR9&`:r%!*'Tꂗ.+}5vMc R)I<)IA+H$)S'IJc*o`dj9I8)4颉BJJϊwGa{VqR(NE'PqS0<6f|UfJ-R[=Ɗc7/"42lq^p^]BM&LӰ;!zV׎y+G*ڱI%+}$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$^V͎/aG}Ycu31XhcB\&5UU2V#hr>J"~Κ-pdf]D5NA"NZ}v]oJ d0"LPk+OЁ"Z L'')1D 5Gi{[ǟ`k)-RLR BJG7;CI Gl]DJNRkx靶eŸ5!usGL'I%2>?>, "@p3YCsb3|%;C.E$$[-p0r )i$IݺD G/vv %(װX4n#A.>*[Z ZyCmmۜ@ wiI)IHcI;?&!g'S:&=gKD$Cl#7kD$!ufig*\]$eI{AcD'LY )\[&$k0vd2IJJi\ؓ<Րkhy 8v;@@Sem.q,-$+al;YysH|f!iX=3'I':]eaoѢ찇lИ$RS o1u 5L$[tK'IL6~~GBev9ѧ:+l3h"u(nn<"<&IK3}Η5 =u.=Ȧml84@SᵠOP4'J3Bdɞ\jӀ ommM 'L)۠ęxalKw 5!l8RYhf֖ ~I$2JfeA;FtL?y q{ԩ80)'I$াK@{*$Ja EI[Ds?ʼn3} 3V6;{B{Cmfיqr! (J׆Es!l[-Lɫнs0JdIDW=~4cXrb8V~=ۛ 䯻L;Bd4'IL׼8㢃٩n@" m~*sMSRDuDy:ZI^>I$𚔕ں{8c.ձdh\O.RBy7FɈ(} Dp#:EfG.RH&7`0 I&cFR&"xLLTH@DĩqALwOD.F U^ i%^HD Š .2a]֎ I5)H II$$I$I)I$I%>I$I$$JU;cü+:V[2he9xQRWs $h$Ysr[!ď{"7Ntט6k5ٵ%L5J,|hmh$AVH"ͧ^w*]Ӧ*D&i{ )WXQƃa(;L$ NN^0h`Jh/$h!.GB#LL'4ZZ"QZht~i0wd $TpN~{78({jsI*|N(nS6'LR k R}И.47w$QR%%!OfݹG4JfC)BS%D%RSOܘC[HN{vL4LRR2{D5M<%I RM4R3-$h%0a+iO)2o&7SɉLyI1)$I8*@llFJ~4JbtL&2Q o }b%#hŽH }<2iILvOtn&Jx"tQQILZt(hRaC)HjI%#k"@> hR $l1L#S)8Qm I0*RwQ 2aPe"{%:hthe_-JAL'o׎mɜe)IJ'sw*B=Lmr!H4;F~&: )Fܔ'^ȌnGgõM9$a%(B 8˄LEL `JCcʓ%'RQژILv>E.f2|;)0 ݪ*wH)U:W)@`#v /x^Or~ӛmO?w / X Sً&ͬJKhI/Uzt!yH-Me/Ti8PI$KI$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$K9 پ0+4T~!L7*\^y ,퀑+x'<ouDžyhOBŽlVXshk +>mkjc1ΟNHLE 1kZ#s%nlis"8ΰ;==qIi L2 b`9H Uz3q"`hn?J#9Ӹ }' $q9 a%o) NBI$EL uAhc i,X*{ h Ya|RO )HEvi_W3 UqfkL{I$Tۋ[7sN˘sR2 kH >ZLkJxI S]lOyUz]{HPH3jdI2EM]ZV۠QLJh26G0RI$҂Y5 4I !dI AD t:A$5m~($i&@ǏRcZrA75`~bI:d@qA :u]:d)c8 ;j81x AD} IUX8ByH5vecFg*͢'hDzB$?I:H)ѵ{vLa-DhH ]IA֐Ԧ"RIK.2,MCb&VYpGnOtɑBȮfNw0L7XZǂZ`x+ư4$$2tTsexh]Kݯ!omUn5ƃM| Fw$S )m=[% ,髜ީRLPRkI:sGd1O[g0 AvRtZdNL SC 0~(6!ʬhdODaQiR*X zw֌S^K^^?"éň,'7Y\3])hNSJ^;½eq֏qRf'OH4^D65OyzmlV(p/H&.jt9@㵆\aӸ3:P]e䆘ВCT)/kߴ %N\I O58v RI(NX$n#ˇ14LP7

΁G<{'h]Tqs`%W[Aw>2{uK5)@34*:%6ä# Sh,nA w#E FI$I$$I._tY{W9:]JU|O`CG+R I)4kk.[`&c}]iWCNfݵ^W3eocD4y-MZ5Sc)4i#NT˝g̠ZKL L:"C 5)Ilz'hdI(v3off;5CnC A%H2AJIq ?Qkʃk)Ήá@Ĥis1dτgsce#^^ȓ(m% vus:V?tLPwDhT.<9H9$5/:腰C-C'1KDR M9Bcv|bNiV$7"Ž"%ҍ[28!H F0 TtCaRSJ粍ė"!]axy!Z j2I~दw)mLwv2p:~*s#))[r(.5;&.J`2tIL w7j:+!)(A5 RSaIqaLdBhRE"M Dv΅1yN`'N:DbT˚t[K$ֺ[ JyJA:(f׷qr{)&Le*S+\ ȒT pΈ1P:TNEKJKKs O*[@N'PA%ݓh5♀?q\ 'N$+`a;o:DHԩ$vI]Kk牔մ{)X7!1l%Ԥ%))T8Y1F}/ͅ4 '&SLƻuOQc@FlNLD %I[lSg)G=A3ߕ)L$S })AiI$$$Ħ SD"SN:@KJY)HAD22%,ڀ"Y(b&{)QRD&wॷ@dԋ d&P'T sA.AFkD iM RRJ[ ʃΩT11q)oLǂa:i"R  8D(I)h5Q*&L!~^r}4dO#E&(hwJ($)v. #D4 ˄Fu̐"K y0=y& }^l4쭶M9CrSIL$^)4m%KJyB~@#(Bt:(Ec`: v'Y#H#o4aLj4<$I"@CC\d"Nv]*OD4I)NJJYΐ0)DS"f{8ĥR7KF9i.q#KjuAa:dJjK oihsaZa'i! Xߥ-TI$Tʫ KL(>wH=RnP$vA_nI% $=FP +2BN[]4Nr, ᮝRI)H$6WR ~r#k/: .%I$ۏ] \uU\t:ō$4&?K 91)w ϚE4 X>v cKLH ǗhAO$S lv JUb CxlPmNT)jR&I axgN|R$0'F:D:IS1.PvAJ T*bkp ˌpO}R4E{(1"<'Wlʹ(+O(nY<ܽ]FX1EI$NZI$I%)$_I%>I$L&GWP%)1N}a᠟zGNΝ@I]+FW[Y* -N}&Y y)p1?iI $a@'L3 6?k e%knGrQH0s|D;qQKU]$T}'M~(f!h.'@b ;B`D9 i'|k8p`)[R1kB^:G 29RRJFR%.ܡ o [CH0ᇺw*N̠&~SO*g~&ڨ˵nRSmaDJsAHQP5aYP<2̦FJ}k J0 BVA {C APp%◸pPHKj<$헷l7G~U&e qkI\yBKiD$v IMs n*, ¨rקt8OQe%7+{ rTVDs(i#lĥ$Rkt=ж;1ܴbɒImWn֝t<#P,&fy*86 tPS $7crjI> $BFӒID9R.oViTw`׸rtB )薒[w^!NKO0Be@'-$;>UitP rc0%&k\ԧ7Ȫ{Bw $JK2G \RuvO )6K>I*/ B )D٭ hz|SP*Q%KhIMݲjfǴ akDb;m mI 7IܪDr6Q6{1:$b5zZA:DvJKlӬ/S P&@7Y憔[BJmOu0eE<0쇷NP(Bm)]u*cH=^o"z`cHoL *e nc"; CPĶSvYs!# !D1>Ĕ>GxF7hB Ls$S–ăJm>=*ڌvQyPڗyR MqZ1*G3ܖޣ D%6 @lS*m|I 9 50LY$:hSr&4*KL;IIL?$2Ԅ1jJm1FxsNU g0uQㄡV𒙹]R.OeMMS792D3DF0ZԚCt3x 6:.x>ZftT|sgD3Db4"u&[U25;A!0XHt#YycE/ܔ3ࢌS@I-ƻIeB'U3cft@397bb[Zs7NT:- ĭ~{Ww^ò>ayR=E׸.ʒǂpldCI VZ}_``WCC@Ր]$OԒI$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$[U=?ی^?/Zu"tzmlrV?OoQ^b+5BO:~Hw\džK\PPJH q-C#s#M9%lt=cqD>' )tS(~NA瀡膳p{N7iI)$JIEJs$ITdx$}9quc'qTS2ѸLp?wr{W @Wld1ۚ\y3$<"2[:쭌c$#-,oj4uԆII#d SVڛA±8?eWGu]n"dJS'A)-#RtΧ|}̨c !I SJiRgd 'I<9mm";atZD|9I4򕥯pE@>`u3͂`؈(7sA0`` k!*6AMPA$ʅ3')JdksIspnJqD(7ln3:Jt0NE"F੻1@+M/t6j NI!{$jLxSkZ4"~hc紧LI)..ipn'sFFo4I$JP}qHNdJVш']Nqw޴"hZG"[k D`Tҷ8yϷqyqpp-nsA`$bcEF\]N)q)spxZ}6ø81$kq+.RY̦ Dw9M伏\'GcFA$O)vSdϑ:V ;2R͡ aXᬇJxR #DফlqB] <4l _YOI1JRNCw8h FNRDASGxRCY%]d:&9 &&kͦuxVIs#ND #H (5f5zƨ?pDi%)I(I,u)vSt Lr:DGt DR"wǺ. 晌ɂAnnxp*ut3jS>+þoRⱖQN!`Z4߂2-:I$z$I$I)I$I%>I$]?9B~k] };.; 0~_ 12e٭.?YBg, puUzzJ*@i(W5Loի<T{ڴ񽘦#RO"cM <`u \Fgo&$Y$D BA :%MԎɈS$ $eGRK">*D{NtRR% uN6?8NNUoY2GdG1IMgtT!< T}'SJ\$#HpJd%8O*)$O ơtRRQ$!ۻB*Jκ#i S]wSAS#I )AK5r8S4 {GtAB[eHC)K||4Qn$ĥ"uCd-u6浾'A-&TR12:)O )($]0JMsiMIHT]>Q-١:*0JD+0?&H: $˽GI)NiS\ ) eXr4 =u41rb%5&,VyKݩH'$)lF-Z)R)%0"$Qvה Jt)JJBXf! Ԣ>H4IH{1:D )NRB3^(o-T]YSR%DlLajX fsvTAEF)WP^:ʓXO Uwj;+ {6ILd5ʀlJ-uaBre*e9VZ#Exmh1LΪ@"4DMKۡD9AL x8h"S&R6뢛*қt&ܒ Ct) J?)0S'Cwޒ6v z1>wX| <",<fAi+y\׬ٍǽ%:#vnT:1Lkom9uH<_uX浤kFi$JL&__#&1~m1$ΟX^wH$ n~̠Zuh ,%Z [ 6%Eޝ;C$I'Hsk{dNEJ!dٸ;P3k'NV;qlxV)V@1!4htYih>$(]#Epy$t9@>GtBSPN_A ;HlҪv4F`AFLS5Z*T: i㲼Kf0."F I$ }ĖN9*l`TS/$LB `dIJGmQw ?R5DC<4GI<&:$1μ;ipkGpvM {[<ׇ:O"Bt)ka>vVe4٘ +, $ '%OuDze1$/͆h;DO!v3"I$|PS6t疷'e$6D=8!6$JRT0cUZ惨@$)6FI:A$~H>$]cdji'|SJSJJ`ٓ`$|;u(xtLHߔJ[<$!VY"C-"t$¶1ސwOoGsZ8 DH> ;YMaEaZI I,Xl_45XCXy)\D;(r])BSݡ mI$OMSgW.G[;O}ũu//_,cƂB{薽:6B$G"D1YDžn8¨1Rn:_1( JJav\*qOf5 7P6Q'O2SRc˸$uhV6; J|ȎHxJIDZ`M80h5qߟ))!<1bbyJߣw* &yLZY!:ba%2x(DKpp}l "Sp{$tѨl's lS)4S &{1B4H萮5N *\$:wObh 4ݸX׆-~/5T+|pk)AH/d !1.q@55&TB@Hl փ@faI[ښAsw4Iv/O)88?)s< {L4-w!?H )W{+02@ ʍqdOQ{~d2tN Z 晁lhc-Im@JI$n!6Ft|J|.iyAqݹ.=GkAeTM)#hrA;$8RaI$JЮov)h9$}ӨN jhVH"5>j{ڛA:Wv2 @ A$)aA ==V'q-< U`wX1 ?u$MxA+VEMuDk=rno:#3c<pG^$9I(J`xmMArI:?AN{&.xLD&ܤJJbܧR͎`Wwv9[Lܪc#BgIL|ByI$#mtcpn:m&(oߢX&I!2I")9PD#_N4ưcC{U3П?s*0vi4Hh 0ALkUis֓o#*L$RSf8T$TmL (8j7mAP%1@fFKTN}8$qyyt8?0HBxIMV o!;\T- X@"?\'Q05 ѷ'6ZdPK˃ #PHO)r%0~;kHuCF`u\ɭ$ƤFV90|{I2HMs@':Y {4L)$dF=:]/<򩲇i_wX xs:IjE~Ѷu\To0 ,Oulom̓qqۣSJe$phѦ'")0cyԩ3k\pK6f[:<|J5H.W7#FiIIA5$6AsEՇϵz~C:GevN3'υYt̟F53kEi1I$R㗴p DwKrNƑ!_6M)AMw_G |pdβ`r Nd'HBHFC؈FXX1&hvSుp^$)$5/&tLKF#4Ic`S%)pIK=ů:n4_H3_LZ!iSgI$v'$wuӿ q_졇 A NSJdݨ,.>@@qI$}m{LՎI"8mmiASBȰS[<5]u#IZ2ac1A-Sq\ōۢ>d^5׺rIU5(8& J8y,Wsgѵ@HBxpl?(k &dO&m7;I|Hly=ֻ͐:n䄔`hʙh3Hsɀp TNO)ELc IrN#͆RL%S A?4nILc"$<*BEHG`I9)6y 4`h R;H25G`FAC=ӁJ$ )yl$wR %ESF4ϚD)SJJdNNA`1}!ܩ(HbKۧ(!Hi08I.$=R A*K-7dT@&&A);Ob؉LR% a:vI5r}'YvI:PI)p wDO j'5 -)) V};`'*%-#+uW15"I)L =L]jbn IJID &Ofw0. K=$M!s%49)L p )rt3YZgG1%-΂S䝀̝Bv& A>$S'{] 3)4Oa9*3%-0Jpҙ~=)TLS OqajbL#Y)ĄJX0mxMe#Y:R2m~J\Syy){FaR^-옂QjOD #CD:#!3QIL0TYcSFGpQ;(ia<պ'T 3?8@w(Z[-:hn1;,E;M'ƱD5<2KRAQ)p0g-u#CC$L)5Đ`JbBy" l)si0cY4rI%2tJkfJ]=у@'r)ʉILh-!L8A%Ef|_DN!r7p> |2hЯ(ݹ,//G{8Ʋ{6*wBnIĨv8?ޮ d,TIJ$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$Hsl6+ž6ct^dGhX7ɽ lcfF7 kumdf{5:¶RtNA{E  g^Y^qh%]RD{Gt*D|~e 8D!ƺ4IUka-쬽 \O{@ vKD)#hMdis@ScY#_"{ :H@aPvhv@E'2IL$Jy'xl0T_00m{ v0QX 褒iI12ev? b%wM,lN 2 )$J_[ty@3Yك䞶p^Sl !}$鼒H)!{CY׳sKڮv41D'IB*CV>PƊnI$/(43Ɖ$$=&[b9Πë3 AILZ.).;ecklaPqcc-H&JSJ`xL|S [V%iUX.GW`qe:ujk9Պy!82Fu^-%df#kk)I HkY{l:좵 $i u1&'DA-GtB۸6\cXE~${)ǒ)LuH*B\6ngJ--#Ts ZLG@ >))I?dqy{Hy)+qvH?5itZp(I Y<Uh;tW5N,-̱LR)^laD@sm׺lVdjP] ~􀔒%3 [w; NG õ=6փ#ϹA: ~JIpJdl>kSh}d!fѤE)NJdlKxnM|Z ?BǠ=]Vև @:n% ) jaI)xpT\L4xB#sÀG ѪHJckAqV~^;DLU98:q5}ڀTIN 0KLi*mf'^_ٮUeBm_?rb8)&iN Y1kgp:wU]c}껃x0a0U#cO(!->˻R14?W8X{B ?WLK'i`hc[Tcpckao|^RŞVf{5`;ZF[]Ms0gRKȽ۰&JYG`!ׂ ԀruQZK$v\e-?JWlǵ`^A$p)&N!l ]2{ˢ@wXbKcBAS$IodSdN vBd jX=k\灵0[D>I"j[uHOLXCZ#J\&EHɒDFZ ˄qROi $!@$ H3ԣ$"@ dkdoR&uBuP~%2l LhywA 㶄'+̿ƃ!՟2ByCxb Y]Z$JI$I$II%>I$k[syi$R-Z18T/dy'"\8Xes?UzYYX*Pj XF&]7Hkh~ta(2\^MD;O{BLBCu0]&vf֍# J{4|MPW4L˸1`L}&r{'ݢ ~T%Ύܩ5ÇwMO)xQ%6";K >$%4yB#ϒR-h@H׺vm@S.R-> D\A&k LB}S-Dէ`P%ܥuH$Z$JO&i>*5jT:E[Mv9@otjKTdbI()oL ]od:N!h% }FHYeTbYN hxJ<7Kɲ `5ׅ0T̨eFS2Go;t%@7c`$FbRHJQ.?Eq%DkMPW}}2++jeKu=FN~B/;dBdnT|\BI$`zĒI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$R )I$}ݍ-p.>*Ks,ܴۧqy~U33DP3K<'k~Qc,| E3tJeW-L-I Vi0g9,RvoMUab>OʔN ihkeISGܯzMP׸5O?d`d%Jk9h$GBcyq.tD|эBsevN$R#av洱ѠH!:D}K^@i$}8{Ijj]qȕxjDikR"|$Kˁ$!4ӏf5a6ߤ0 %*qi&xMeu Χ}T6\%.[ێۿ=$G8)o`pբC8 3?1]08i17S'#_%)Fv8^LrU|QpkUs߿TI$4^O٦<퉞U?Oi:4Lڝ )'ALqwtQH~3?F'PSН2-@w#܎v?L"0q 4N|Scc[FE+ G:'k矂 ov9)%R @F 9.ݰL+6eQ*XbGQ:8}M q0\6$0cd+osZw N%2m 2V?QKCYK6I+ā2[H:rYh4&T" RI"!"C*> ZI. 4Z/IFtNSJ@! W'su:);*i@h'CT7CvĦkI|bRhZX[_<ϹT{[32间hBiFHJtJЃc lJ=`CadVƸZN[ iirt詯Tz{;tNok 08enAi4sLGI Hg/C_N$R!>n֟>%.4JRLR:]kt9&e?Y( 5A34l"{)G)NQs:xǶI"Ly,x= 1X. x$BI'CZK\|{x; FPAy!z^Ƙ{(drdQ]併%wmSpkuRϭ-yRsᕌ뎚 ┤D ݯ!@@QuPhX֝IV^7 4w i_]߲]t̂>Au,` Pm;]#(Dɩt=6Z$k'F6{=sx)ϒI&<"l .254h &s6R}J]RiQNBȀ"5+#KB دpouaQ-u=I) g1v0 YvQ)'LJҥ2e5h0bZr ?$I$jkLަ:? wI.RN8wV%DA=mnsXiplwDJA.ip' 袱xIJR7qu&5S t~N$B]R0 rĈ O|K=̙I"'DI, LG&_)ta"@'KD)% ]OysO(2y=Ԍ;S3HILϟD$#\7ɫv+ױ}O|57ysSѝGpKq$I\`]$I$IJI$I%>I$I$$Hؙv-ŏY+܁/2DedÂ"FT#hs ~Ub3v9 ,4Zy{KļehEs,W{̹_k(${C[Oނ-6c-X˲r>V6Lra0Oj5s)7Ho;)OJQ Nt \;{IN4j41PS 6?0'Je@/.:?rf̀;eI%"v<OAI'h>g_}/4)% !wmEXւRS#3$Gt}{$Y8p`IҞBD) 5Հa I-SHrQRG?P#NTK>5N @d꒘=JQp1#ɧ1$$2Sӷ m>*GzZ4K^G}T ;JH hRU<## ba%vD@;*$wM0tRqQ+\8S $jxBc{% HvUкN7c3ť>UT qFW2@i̬7y*I%aZtI$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I;|S+ Ȭ I I$Dž}KnY>U:F|5܉.8VZc{ecOogu.WNb5KBc@1B!tTh.xEސIF_IMcM8(WYAQeրZI&H ywxjE- {{wk.8ħ 2)z{\$475C~s>axvg NL$V lbd $"9CCG vR`&tМ"5X[~*Iqg@Ul=n[@.ʌtmHo].1'L4PC[NIB(kI0%4wsLh=PKpI2I R~߸V-Hv@s[#Dg6 I R e1۱B-䟊kl}l夈:C`.ke$28IS2X|XI>V*`0U!S`5{I)EH@`)DɎ nm#Rn+zwLTJLw:HUw$hAY/`yV~fx)OH)wt* 纄4!AE$)JD"uG:J+[-0 y!Sb[(skn'HRMJBK~?4K5<&gA䤢yAHI{5'ӹ 'CjA?uL%O:vիq:E[GxU9"a7"Rټ)q- iTȉfyI\ "S7櫾\gRq{YK1(\;$ Rh-5ȤmN]cH0d$8Lb@-V1!! [ nif<U.l=tI9 w` :q<Vln>Cڛ8J'NB4IVz|hBs{X i M 0wLQ'.;q'+C!'$0@ǚơ͘Ъ0xQHMK@+q;&>$<ʞ>ݠNDA"+iu-ݴjO!䴵 =kNI)ݞ6Dӗ)j<(!UI$]I$I$I/I%>I$I$$I$A%)2tzԪ__NΓ+n?|Jk#l^ޠ\&4n}j9< K`t.4&%-y%Le'LIt.< :^RJP}ѡHV'LqgFݜdHJcTTv:&gT̯l)؜%$)IL)ʖ#晍C}":)IK |R $4 ôkv4'GGNRb: 1)7SINh HО|ptKSwRĤocZwqR'%3FL:Jcldž* pIڄ0rx"?D$iNZwS5HAŲ~H CE.yA,II\Ϛ` Fa1;!f4N4IIMrÝQsȍ]E$k߲E#L )` O A'G .p @Go$08R !.Nǚis 5E񦐒yLGdIU`:꘴o2\It Dp𘤦vΑ*Dxx$3\ ?/$RS= $#Y{'MBx$-;FT;vXCd#Ôײi <I%[wHOrR)AJ* iƺa$@>梐'&ȩ;8'nIH$$]mm0> ܠtR:4X+E<6KG0(II!{;6 )nqtI<%I1*;K$ T!MjIdŦ"; DDZROJf C&TZ43*s?yJuɦt 2RM\%Ð9L(^: Ha9v`M)%@AM3bFhSRLSĠ6A0S93\&](r*-#hi)CSq#6 0nl xD5-i|SpB*6: 7B@cfHQ;O!K2㦿i҅Tkk;ƧZdAֹյ887}$'I7Y(.$tS?·QȺ&X&GIsn?Te(L|'\ y᠝5NJ/ZX`k}J$L EK 67YN(n{l{[ HQcCd&4)&$=͍(lF%"_@%蘔Pdʺ*n3LlӄŮ{#R B@? 6C"IO_Ys)d!yR}Nt%.:A?\st׿8)4S7+6w;EKz M@|S_K^ l3TI$4mm*a$iKk߲( ׶BI'$@:(ᷖ9Z6T pI5Vֆ٣AɁ4FE+$\ӷM's*MNx1&+p&ymZ-gr'R'DҦudk>*ݖoxhƥUqܬbiA& d IcDtSxL3[WBuqR&X.h $ " \K@TpѸ{W0ǎbhJ P )xs$vN.t:ǟ򓴩 }zT`++-v"%;VqV04Ab 9ӕAA.S&NRLKeFH&LwL$ $ F;'pcwjX&]%3X''L66MdږuT-p#(LRiDh(!x:L OGXfx]F#T乊y>f.i$[ FI$I$I/I%>I$I$$I#~Em{G‬fUMf/l}$)Blc SBxeOs^ÍvsCN8vwsˬs2K*s`Uܷv `ٹл&S])5E9/'AsDĤBdN;5f=IxN*SJ\xo] 9PcKZ2m%:9IKy3&k< #Dž" #s~%(죹>JJb8Y)8"T<&ԥK|Y.Ԏ?OA0K~=ƒBNlLtD$%2]PB *CMRSbuC鸍GF 7 qKB2CP ÁѤ4+uf Q)79$-1%'n'!II? q)mPJ#Swj8|S5夵'I)yԁ`A<&%D'2Jd0YdjZcʛuwS)L?%1 0ʓtQc#RyGTS2@Si0 %JOU1$i)m1U>XȮ:d 0, 4+JA}̪?*t I0:%%dɔIXk`$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$^-rدI/1Z>/OH`Ž 5t~AHk~$eRdY 4…cۻ=Qq;F5'ɴ BHDZ:Dh~J{0S)pILv솁Q#sH<Ʃ \&"g8ֆ$%Jdi}Bx>_ANwwr(ILkp AA*a\DIe]'棌m O4IK@JS, K/? ZѴ<vѴ 9 )HK;IL~f~{2uL=Q܀_%ut! /um)&HXuN8p)1?Gl}Gd铔ʻ ~*>񦺈6#FIS\L5L tT&̆;Gr9'A whk$8l%wo$4N K#owdܑ፝E]^{܀ $HI)EK0jI$)RL!_۰J~1 4Hn&#tF2ܫ=RטNk d[Hxgq3$L$ usDv=o89'xR]$'))X kv 2er#|XSFBtRH #FO3A7t$ Bp qtIJh;|ORtE.n؅!RI)I2i$Ν)'Yf@ԧYOd4"h:$Fwn<5FiCBo2^bwCuÇOX|khO\g:P\I$mԒI$I%)$_I%>I$I$$I-_k3N> n[åzE1K?ey!Fo,We]S4%i޽VB7 &Z7 l>GTope #ЩDTN CRPcI4 F֐rS"SʂW,.NZ:Rw@t MgL%: D2~)$ ?p}H$JDcNN1vN-5 (I*^>),O05 (Dv4Ɲ҈ ZLRƢN9 9 Kw(M)R!N v|)4M?rJbOx=ӂqE7 jy M) !v D9)4mRtR)IYbu\-@d퓢%$2'I@ i&ܞ{$S30{}Ѣ(mJ4NKk\}t7vI1|RJb'^ nuӄB8I%idI?s─5DsMriL J24R`;&qp2Q R dP#GS)3D 8Ӕ )#>:jo։wpnfqnIF) D4Jv$BJZ4=$P_jH$vyO<=]vSu"{N `#y MҚƊ $<)NJIN% ò(Q6߲yL䤦*#D = >a7)GJJ=΁Ae0>IJ4M$lt$ZKfJe4LJy Jd֓Ϊ 7tR{0>䒄SJdG`)ARu43RQ@}ARj@ILL=R#i'܍T(: D,1اŒȂ)R|Jc0|RXCS ?%DRyyIK2 :)WDiM ' H$Uz'i<+9PΒ5ڂO2bS)!Y$ n@D()JJl<'-=Q o|S%NOd@) G(N4 h8L|e? SI|QZZt &STLvO 69 R``&N*e)$(4H=^xu_G JddJ~c>ǟq ԯIay$Jfm:`$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$^,D>+X&/K5#YX<Ž XƨO0ߕD1Ja %05Tnl';@#]868i/;}S̔!>  G, S#]5NuKN"M!T3%D5@,F`'TlzcCcݽA lgޅfK  w #Ѣmԡ"[epNS.%?U *dt (҈)A.U0@P 6 &d6Hh;*uװIt☼*RA8 i$I,׷T[\`i:cob9JtI'p9PC۷ֆĬ4H C ۧ-HMȔdRcV S yxrr<>mo#c tؓsx9=zl N ~|&[SN%.kq8q#Gޠ >m>x$I$Q;kp$I2~R8jkD %$М) $s#tʅL4 )FQVpaxS|x/hOV:݊hU?ʙzav6I%l$I$I)I$I%>I$I$$I.MnFC^$V XYz_*kZ|L蛑p|PJ-Cńyj7H%L;&{'ALs O͛hhQ4N?"R&R.ANRvԦi7LurSM2d<Φ & q^0)*5{.u5*<81N Eeڷ"LiӈNב.Ԅݼ@I3დ i#x 8%$C2<~)ãDTR!%, 6gH8IѬ$J`F)Ds͂IԐSC)b!<{R0}Ǻ$(S)DwILM: s $R4vCB]ׄw"~;Ɂ}[ĸFd{#:i쒖i { -GDž?RR$Z$JHt y$5)Dr!%,X2DNV9A8I?dR-qӅ 2A"y;)(D'O*]Cq! q$DS☄)$4͟d$Zzc΁,ARR}@$g)JPKjH _H:Cf{h;?D K '^ &)JH꼑S܍ImgGùI27@'ts@$em@*,l4H.>*onƃ! %"KZ?{,245 ms쓰LZIdJC3?y-$LGs\3i{7F?M)SB+bN u h u>?GsˣtOs'PA-0gRPXs=NCe:!d|R NCCATr&?y}@ N IRLMzm1pӄVnk'nTsGCDk[c5"D|v 'В d472؇rB#!d{4#OI1DX^n  Až?> z$:REJc?Hr!&1DI wS$4b#R<$@쵐ΜV4KQ|SlG KyEL-Hh35ֺIn ?8RAy=12t8ߥ6;P[:xǺƁ1ZK@n_:I$3tml)EUg^2D2gO$Hi*_pxBN,$C xtd xB}>6@oP4IKՐ$o{[;$`#P&LC\ARN'0, \ Dx()%Ƽ[+,opggF&Kmi-hGu˛adS!"{<9nTaFkwk"gv( UwY%D=fbS%bZKq#QGiOH<'L+^1Aw c 5,~{}>jMLBe"*2= o 0  i} =|4:ǏJIBxMS` PA/"t $RMH5퉇AӲ>I6@3EHܦJ\5AIHN;Gt6LlstwDH-aLր9QhuJD NJc.qBT\I>;&I9M()vO!Hꙮ JN4ӿtd&KmcDt$L& ] NԮ>k3^ ֟f啫2r[H4yI$ZT$I$JRI$I%>I$I$$J1ʽR1kG ^g1E&/RL,-m X3Px8+~=KΑma'qѠ lj+åS} V)H%B M&R$ #zcIx4RSƤ))gCZS{6Ԅ9)$ѣ9o%8CU6$jƸCeI"ӡI?$ $htR|xQ蜄r<%M0#=FK@ & vJe%(Ί>$rbͺ5H&%$ MMY `10H𔤦asOHq  %/Qڝ;%>FI)L'ĩmg:~o>IS));'h<Rs :NdRclL8DlR H0R'Ts/o*ՙ:tF(OS% R`NÕjaVm|VfPTry2 -_D>jMdR&xM"uM:mJCOI<)%#>2)}A'1ѣ]JqD&)p䊕$I'(.:i)OGD&4Q焔fLX7NvspQvܘE +[";Pto}FJi^Ak$Mߕ| vyы#Ѩ`5NJ$I$5$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$d J_cMV3v, Ԃ)kf25OMkF IɄ&.%ִĠ`$fgEa=(h_$N4Kn$0G&oHGh)q64JxH%ID _iSW )IpsC`6=R hEtQC ƬlWkaayEdx?&L&0*=K{) ~i' P8ʋ7]v#8c) 0t$"%0I5L ֒忛iJ%:A%.Z5_M'oa!B\'I%)K m lLGtFR洹Qi$NBE$8y!;{d#dW1t:j >i$H@#DYX~>}VyIaAAd0:ajK"9Hn9Vb#YQ$I)Q'~J6TgȠT[ `lhU;TƖ[$Tc&UFT!]`h.q{d5)5%EAMN H OD$I)j:"XOϲbu})J~))%#LInx-H-T$))EDrT(\h47DpP*]h@#HOw)$H ZN0tTfAJ&ry> )a%FHhti tO+'WqxMuW\Fh:Eo;s QI$I$$KUYNc9JZWWcp{ 8j]F{|Cwe6QHl^qkd༉s. ~sCH+PݑD]w(=jѣed|5ƪەo({fFMyq8'T\R-!@pZ5D?QHd$]Ӏ1YύLiχ)TuRS"( h#BS#CHp9Bf.R-<'R')$LjL1<06>3bIK tILnj$8>'IJ']TKGvOB1J[Ą-E )D М$xd蜼>ho|L४JX6ƺ{A8 y-&$B*`k2;U/& 5QD xIKXg&[߷=m4&H${zs2ƍ!Yt`1@jS>h:Gd|NhRRP5xh]9iHJh))N`p|4S -><ΉD<%=RG[F q $$Ҕo4'N f`{s $JUʹS\tS #Ex+?VrL.Q7^`tfW*,w8+P`_Sp>'G~KBƠcڛ@$HRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I.Zde:Q⼏]6s\|m7pY5Op4`h>bpc@$A Ժ4d'?=BՆμO)p꒙x v^RH= PݽxDNmp?|܌+]`C tyS<}6jJp"jv)8S~6 1sGyK$IJ ~U<$4N784;(u.p-&G\%)LL&Ψh.yPmnq?D}pRH&I H"F!ZNkwޤnH'!%2aKI!i ?Q{!9@YtA2xLR)%%@DZS\=@*l& :E0K$u.3ThvOm24G{:8 %0%$y-l7LĨq&yKa:}E00$yK@RdAK"Lym`@ $5RM (c` f4B{<FKt)LBspkVZ:F=hos:90<%)DZ2痴E7O>n"K~ @ %`\]O'{ʖPo0c7r qk}i |RKR j1O,qʍzM|a%$H꒖c!dOx`=IJd>H%9A:w9MPxk^tɭWm z lr%.S'LR*k*c :?A\'qVw3%mή2yI2jW>Z6K;SQk @y-J@&JQ SlAU,%8K66}#⦢yBA zvsP-1cNbԲ==6qc`AIxLtO tmvޒKX^טsZΣH2"Nԝ[ÀЈC}?k2d*u1dnԙZ5IY,Dsn62p`R[dhAr9*͚u :I&%%0dhW|QwǺPR S89kLE59$A:A ys =L@q&|Ge 3J:)!BOil]uQ6".Sr %&ӂ{Geѻwe1u I$I$$I+=4TsVW:=ͧ2CĤ?|h'1|az$44@ƃ4E l@I*!*]H Bו( 3K6@0|qn?wxIǰL< d))=Z= gB&8?.BQ5)r읻Gtn֑)-_醚wLA%:rPԇpuLbRJ5E ?Ƈ!ā?$rr5L $@ׅK-RmXeۀuIKq) LN9:RJHG={q3HrQ%Kp<&i k>y'<FI|Rly&Fp!(M'>iEK(R'q`D2N'O)=E'Dy&>dqp*nW( ~)4xSS+T_n;'S2G!!̧0!߂J.$GO :&)ku,DpGI1HhIK8OBDχtBg͂xL $|!%2-/05:$ypt$RJ\7G(5d;ZP18E@ % ]:%98KYk *HHEaE"9M25Z}B)i}t'A)IL'sCA1>*loqm'RTO)RH>;g'4=H8&.P.L^L)@q(v&{ N:k2D&DT#!S7۵ V 'c!n$tI%(Ԧu_>:LJvXׂ#)pS$m`pJk,kpH4B74D2U:Twx\ Fk\Zt6ݳuLn\$ :$/AE& OyQ>a:5)8$9jt)%(/α9\ϗzE(]S&:G^CЎ|"H*mՇN;SħD_s~v`¬֖*ͤI''IHX<m]$pfkRJS'))#nASS_1wA?f6xH&O0ILwT2@Pc@y MpRRŵ홑_y>%t''QiS7 lh!P:|QMխ1#NK{A<$I"!ZACOYdu/kCHn]$KMh$O%$<=@]=Bkl I'IJLJpIԒR,dA_ Ft> RKDRjD\?9sXw{ mH3')rJg%x3V9Q ;SN$RG<yYkP1b85rӦ&5n{x HL‰%ĐK\ s?黹HhTJ`a:'];fCQ&ܘ4XvEcqeD#S<׎\wt=bIԿw'&n<0BA7Q7bR)`9xTAlNC) L|'IOT6"iA&4)znБ1!${zJTk)'EcQ%@n&#hR|SU-NB?q_ LSL?T):*D$|Li6>ѧ©xO`ej_XYkwwRrLH^> 5e I$I$$I'aALJRd/]PTd@ZmW [#WjJCVpl[_Ys,6$XѝѾ^^>+ϟQ~E)!5L:]m.Ŏ$ǙCd(X}e #49: bG'@9")ǞBj{΢5 e 9?D(%c-#e}$|q<䘝&iBEbOb@ ͚!=`/${ BI`,}>NldL;9H& )x1k"LmDp%:@Ʃnu#`yKkDS%4JD:~ ؓۄI! Y&[اݤO xI?dҘEK!@q q) 4nO:$.<5Md J t:rg7t<&#S)H27OuGfnǒ`iE  ΍8("I# @A:$g^u3nwJPR;@kNvKPR#M*A)cL ͎TC=!AlJ:&NHGu#Ò@Nrdɉ750Ԁ4R8MSk%1)O`)10s85)Odd&|Q 2=iI4pgŮt̤k'^4}遂IJH-se9S$Dऑ2#ED@FHOtNHIK4f$J[aIDIK 0N9vˆ8yMJe%,"@VF',#_ʔK蝣qIJk{' fHk! !L9*Ҥ v) ufմ?YƒΊ,R ܬ<߭8BGx7TVMupIhteXI=fȩtEਗȳ3Ϲo܌> eN(YCY2{.Q87}It ȟ7oou=gGm"|^W rcXJkyq^G.'<[yT@x`?#^Gx1#ߠ yU_?jpw{ p;䇫fns6?C:? ?rqHihUz.+IƏqltX<{Ę~ /ռ x|nk >hahX}B]]f꫗{2 ;ZA+F,y{`#BI$ C+pS>q\Oޥׅ&d"9մyqWQdD葠hLިƎFR얭ɉ >j}mRG"5Z{ {z8ThMb ОSXkHV'IIA. $*^INgȬ9{GFC>Ի)Y`yy~(/sӢmUYG*mg!HLNJ^;+ -4q0D+S B2 p5먵Ğ_f">ܻ) Zkٙ[5°xNŠhyRnm\H3H.ԅ3YN8(ƍgcXHp})àʦr8 7O /aj|G%یʰk xRSZCDkġhɉ-fJ_i!*U#[3Nh>-" GnDiL  HOKUR:p 5ӻ{7c]#C}>U2!%@9;JTA0v T (4NK`S BJ^}d(B4P kR'TD۵Ш/[kI1T_MPe{7DIP'Mw)Mx[ģ33DjR]vXX @3D`?F(%G1+A%;buF0>?݊wh7RKgh֔fkW?݊}wsC>)A>?zIu/PwKG.ooއ-LϯAdr`+I1W.#1ȍ6t!i+?$S4(̯6IFy\'W{pewޛm/OL^2/=2-̰s|PRRq²S2ͣUYt-00mh:I$z$I$I)I$I$JRI$I%>I$I$$I$I)I$>eV i0\1d9KI$;e,KO!sR/Mn?5$7fVw5>+ȓżL0 βf kpAYR̢? U%#_51jWxdk?xpqFyxAAp> ؓBAA#F*ȫXI;K'>4zUIX:Z` /b},,h{o^I_ZͯJ޳oӹ懶0px3G.+߃[Bjq5|H^~șqV \KW|.C'tW GzѾR5q \ > oܗ0pșpZ+kVzy̯OkSn3`Z>@ q>Sen@uIz[GtUWGp.*T{p>D"7`cNCw|cۣIn}w8-j-l4!vER01A߯==ܹ҇WKN4 \q \?l YBv{Ȯx o ^'߭=5KSo*G ։n0oܺ;>vUwt<ҮP:%{K5^nZ{%Gd7asv5P8ŇRQ]8JuUt?i/W-)ZO;q/) )Jkԫ-ywR#HM! :ҭgNkpMrw~%VSp*څy)58WN?)!JD#IL^naA`j +88WF v?c|T7ؙ'U' R~hYour$h$xъtX\_cZ;tZoUuwUs^蔩g^B6ܷRJ?Sr|]]&_P׻%[MRX)$IAUHVA:I$HRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$:J'R3C~kD}p`@ $Ů#bB8TtuiB=<w޳GvWtr߹%m_18+M$#`*`/ISI^o\oNnwި$=XyhzVR&MŮD=oLji>4s}MY%;+G3Gܗ_%9:W'Y+-$8c']}r_eB*KPfJҹe$ {q˺/UMZt}-7}d*2mtUD:#D1j4}^<ܦ:X 1yG_%AV{VR-ު$Yc|FRIkl8F~+WbU\4e!p!h@G> Kf8}:`KJtGEw'1!;d/Od\ #FybIs>Wtp1uි^_F>jV}~l~O$/y} VB^߯9KѫIxRq`4CHi?&{2ucק,^JR1Y>^2L̩x.%jlgNh JH=OD /wH047xP_x=a(oդh?߬x_U^%?1*gA"؀O2J7+oޤ﬘c ~ޫOއ>ʽ=*ַl<:=gv/|gI[ ]ԆuㇻC)ǃ;XZ`}@,]Жнa}/89wޘy{⯼x#+7 /aI /h^vJJhrxӋi#7_B |Ub[iױt_}Kl]yLxd/ ZXsWkyrr&x|?<_F=wi8v#B~h+݆He7xQAw֞m*/y{xbH< Fc 9%HbR8h^ԄP9^(DzӿG;hԲlV8M\~=1qtF= [:(2 FEAqBAW9I%R~?Kޱ#ԡWx'Ue岷0?~(yr|<g1121G Q.w>UQnA^2l}KNg\Xֆr6diIrɔQx~pvV+gR5I$k.I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I5 dR'I[e!Ss8)$(lŦϦƟ '&ߝaOb@\>2$mm`6kS|KBw ssI=zI*vz^#L q\dg&?X}9$ezN 8Bo>'DrI%q3d\T&=Eu%>grG^Pݤ7xtſS(!{+9ցQY5FIz-^0X`;i%^Y$K|o>+Iw>^UW&? /_cGiP5u.%ғ?P0.I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$2k/>e58 j!Uw-uWo1$I%-*_?4I$S*_?4I$S*_?4I$S*_?4I$S*_?4I$S*_?4I$S*_?4I$S*_?4I$S*_?4I$S*_?4I$S*_?4I$S*_?4I$S*_?4I$S*_?4I$S*_?4I$S*_?4I$S*_?4I$S*_?4I$S*_?4I$S*_?4I$S*_?4I$S*_?4I$S*_?4I$S*_?4I$S*_?4I$S*_?4I$S*_?4I$S*_?4I$S*qr0]˽ס]F=vv;^Vg8sI$4I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$jm-%Wo1$I%:I$I$JRI$I$I$I$$I$I)I$I$JRԺ=6d^awbη-*l=$I)w>i:5]1WwYXPsm15tQMtb `UcRI$S[A,~bm%qWI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$jm-%Wo1$I%:I$I$JRI$I$I$I$$I$I)I$I$JR/ պQZ}!Ƿi?oNI$c-EHz`i%ݳK(䱿I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$jm-%Wo1$I%:I$I$JRI$I$I$I$$I$I)I$I$JRnYԺ۹$tI$SBʩ93'k_Ԟa5.p~tI$S= >Fѿ_5cw4rA I$I$IO)W$I$7}P鹕KҷOXe: ;eӤI$ϫ2ΗkKqjw~sX}fްmD3!II$I)~.nwX(p7tZN^k?I$IO+VakxW:c[;?-I$I%!īCvFI$I$I$I%4z .ߚ>}RY&VXD4[ZI$JRo-9,.'y#mXI$IOR?%?;H@I$I%<'BX- Q0ڜ߿U:ԛ򛑖jO7oeAv $I$Z A\'P^AvilgpĒI$R !p&=`FQl9A$I$S/eLi q *UOsg^QwI$I$Q[ٻh%we]4 h)I$I$I$$I$I)I$I$JRI$I$I$I$,Ϭ?љqiϬ?љq$I%:i$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$jm-%Wo1$I%:I$I$JRI$I$I$I$$I$I)I$I$JRlxm d'8c;[81 s+.X.V[zI$JYUu|j|I|v?ιu}Ri {Cֿc1;s^gtdʭ$s7~$I) -"Z6;*>rlq6XwwN;Ye4hwcVWEúhm-H{=$I)T=0uZ:4clfuWѝIXpt6?J5s[1T:}$I) f] -u#l)}o'u*}2]O/'6AMG[ c{VsQiau"5Ώn$I)NY(=oݯ󲲺:^/n,pKtLYc\+wfV6VRgTƬ͖1OI$INL{w{]Xn#;*s nw }R~=g?Kn;~K,|SI$Skc)d}nο㸱ޫDkar)m!X\.c(ckL4NbI$JW ,j nت`\Lg97ּ[r8h޿onew4-kkGѱῶĒI$ fe.Ea4[?.\0%$I%4c循22_kld uUnwٙ[}>Ok ;U/eFI$' hmK3:è\?s+\E/[kߦ0FoBևm!npw|g*I$Jv.[~N>KmU qn>^̪Ͽ%kMdоMluF:KK[-r_nMW4t }$I)OξαSղj`ikwFKYw qi_T]7d7Yf FI$gM>qkՙMF]mv6ȑc?ozMGYǴ~~O\1evmkn;7{礒I$}w:p}'~jU[U1mhK_{?7}?=CfEP \R~n@,氝Xӵ$I%;$I$JRI.S3YkcߣI$k#Eo=FM/WZZ`x snSb:= \ðo70ksޒI$+sMv1^}&9_X_V)PSÚ7X=9Yv^kjTvoO뤒I$I`Ys͕8aۿE bI$IJYX3 *YX3 *I$JtI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$jm-%Wo1$I%:I$I$JRI$I$I$JLg˧mcMxBR=Nq)$T]0 71ۘ9k'Q31Yp`9rS$Y)-o",!J'֯#o3 ֊;Is.kWpYO Wz,vy,#ǐpqe %$JKKu< Xy;TZa77+8D]ǔf*I$Fàdʉ@%^N.T9|1$G1ɖhBb5)I$:I-myn#D0ɞ1`8re*35xTI,d3oz{߂%1q/3 u$KIt}V5Y+Gv?77)#Q]ǗH=I!$m<8LĦs1ԧ.ha3VIa$g K*@Q1D !$I$1^wU#v|īfQ4Z~jI%Τp_pUW瑩[,@~ozY!?Id$C^wf}[}@;D9M?sFqDI$$qٹ|'gի*i}."[keuvgTVr:}5.d% @ԁ] 㳫u6a>̪]̃o[SsJKwh#%;?b}}ΞHw,l,l623su;$I&s09{Jl(u}dXΡvZak}C.mo̮kk!?K?:͟ų{*xuZ6@o?夒I$YX3 *YX3 *I$JtI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$jm-%Wo1$I%:I$I$JRI$I$I$::gY:LJ?q֧9Y~h*$H}JqdgPʽL]6/X\9*o]g"oohJ7&xe?F|,Xy$X2 X9:+]_JG=H~!1XI`^܋Z,xn>*]vOf6;߫*u痘J._peS LbDGJI$ۺ2ni?epG36̳ݣqՈ-|,ѐa4Ã&)=qJI$7`'>GH=`z굆vQ2,Fzd`rgFQRI$z>KS:5N-O)n\a9C\9qq,Y%<9I%_߃"5$jxYW7ȴ>} %TkU62!XIgtέn-qudb^LCls8˖5"bTI(}adh`>zVDG_Ya;ҒI%2ſ} Nҷ:suuLOW"<gA8`1zL)tRI$K?+Ծc(hkv|BłHǒRI$>p$ok*uv `6Ե]7? Fy1RɎ#RI$u_N={kk+%y:`'[}j/P11 j5$JWs7qs\ I!/ˇ.} mr?WNOϋ1`CqRI$ԒId:*Xwc> gd =z\FG[f=TX;2ĒI$]dvo fe3\n[agu&C+lIl'V)3;Tf,k >Η1]זk[unKj7MВUWtC57$جdk2qk01;?qȜl?#tΙZ!Of84<N[[m'k;[v.uEtbG'Xs`Y. h<I-G =^RMmV;7(he7nSXYUcծY`{<gKq:vVGɮ+7aNghWmw?zv-?I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$jm-%Wo1$I%:I$I$JRI$I$I$ێ O,š21+iX彎"3p0 0h\<@%JI$Qr݅#t=nӈܸm|Yyfuc+ØlS<8n8sgeq)$@]_rZJݳ:V3×;sx w$H9/˵Rlp.׎"7-0 yOV3zٴ4)y~kbUflq?RI$Όg[+?%8.9Zvn>H 攧X)$Vh/Rm]~b?m{rHn@E,vsC- g@0\Qϋ$kqgI">;v<#멿JWk,S 5|aǒɟk9&'ԒI%c~cݘ FgP?9;<͕ϸ幌19\|>I%c}^ r` RNϲˉyY"?,fuNkfO~?%[+eVj~s2Y匡8<g[yj߇1g쌚Sv$Ukp{ 8Kscǂcrgٖ9$ZXg=\VNO_&Kp`䐰UU3?$!<^?.I&X3O\qI%o;e_kH$szeNu= f=Բ34Ds< LAe3cRI$s~ېlDh߀UIe#9|^hw#J_L|gМsr/ҊI%{{v2UB˛K0krkXݬ d䬗8$PadxNXrK/bI2I$[U:RPr.I?EV?\a,mI$SY{;au>Da6._hTsj umqz_elί_?y?6=gTeKXn3=FR֖97R.wX)s8@b'gUtNn;ǽk <f>ّHms\KAvC)}pڅg03ֶOQki@KFuI$ܹܫ?N=ճ*P˿{jn6mGI$IOT>FgۜU>FgۜTI$餒I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$jm-%Wo1$I%:I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$K>t;L=[wT?}SC s{8 &ϯ}O&8u?츾|os.s.ݕc/t_a-qcK,k\X /C  30Ʈ ΛާOY=t:eBm<_s=zd-̷& eޟ}^ҭϬO?^f}>=o_ E$?|Z[Ehӯ?~-UStz]S=F\@]nCh{p;}_=fyٹFLy5M~O{=gW$;>_զ;X-{;W0o=k.ޓJcC,hgvU>ھc}UB9Nyߢ1uK}^}^eO%Ձ`l{;l\K꘽ۇ^MO]~7 ]2r 4 ο߲~Ƥ}E%gl߬b-Īʘ[pwne羥jdns8R~w}.%`SmvֽC.ww2Z/.=?*^_0z]WsdoF*^uZ֝Ҭf}L85 `[E=K}pG[IliT=':can{ a&&bZd;=z2zOXP u.ӷbILHϬNEŹ-8G;??~nŇ:w؜綧T4V惡4a~gdd㵛 w Sk}/٫>wܒR\կp1p`{X%#}O.}e蔶 YF?) DW3:K[mᮩw2uoF7F'餪uc?qmnq{I;E |}U$I!I$I%)r~fw]Ѯc}X˹ }OvI$IM.R,0 n捶lUz:Kz}u]l4~m5zN(n֍|\~}7eccnĒI$}8eTO.?;>Q3Y!kv+_W1oa/0ַvgZ̸5SksvI$IMu6e`ӎ+'XݺžtޙGLْNq[I$IJYX3 *YX3 *I$JtI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$jm-%Wo1$I%:I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$k:UZ\:2zWV۶0_cqKLhNM {`2 9$6Qj'2C-sYaW]:^/S`2ƙ@?NUG5^]U8jb[?ͿV^-}Yv6$l>7G*e}dYunaЎ'>Բzs͘:`fr #Wzٛw#]W+7=62Ѿ3:+"?E>u+0-նd: z+KaV jmQMn4ߑh]s_ju>i@ 7p^o/^y2uq<8Y-bIV7f7}nnOO"bIsukYnݯo=ұgu܈.qOg{npC xU6v]w7yS>mku {7k"z%tϫ=/ [usi!C]l}늳&-Iĝ쏬K&EՑO#noIVT$m'D32r?b}]ƾ} ki`g_{G^^SjkinͿGa2hŭ ?[ O`7]Mw7~bì~s W;?YG'8cXvu7VUdYK7lf>꾤g`ft@ƒﹾ U:ugx-D7OܷafS}TǷP!hVj!Ai??uNKK]?Kg~]MUok-j4ƾ-p,o}X Ygu +Me(1}MyۃT/MŭW-?HXqr[/qmusC+ffZβ,$G*nfP64lm[^uoZ8=?nFs3m݌ hs{fꬲ7~uNnm,op?cPUh!6m]}[)ch"ǫ^ rZOewdZy |R .&c}{VwL'Uk;(а/PÌSK3߷պ+%,߳7m7/%1gJ/9 q9[/:ݑkc~+}gwi!AS*YOe[[ 5͞OMdq#ra5u X,ڽ/['_Wt,Kic*lNmUb,A+wQ?0;dMFkÔdyawz[?oQɺ>YY>Wu>]s1h#c*/hfgS?>^YȪ=OIuvFx+Z=oSM^8d?2t-W:k++ccӽMv;f%%mt#ֿ륂:힣=o].'r3YXXuS:=\g-0պ}T1vH u{>@`k,45c Gz~,zQ?xĨ=o CtnW[mpy^u}!أ=t:wYu~gZ7-)s}Cgu&eZjѳF u X7q[t<,{3]+-9ǵog)o]KӺCeop᫣wstNSk6#stI$6I$I$I$I%)$I$IJI$I$RI$I$3?/53?/⤒I$M$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$jm-%Wo1$I%:I$I$JRI$I$I$I$$I$I)I$I$JRI$I$J.{X%I$$2+:7$I)I$I$JRI$I$f8KL%8'ꤒI$i$I$JRI.0<ӤI$$I$I)I$I$JRJpc'SU4I$HQtI$LI$I3\$ I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$3?/53?/⤒I$M$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$jm-%Wo1$I%:I$I$JRI$I$I$I$$I$I)I$I$JRI$I$^)Ջjg]\I$I%>moETʡ0r,:uշ;~=ozjc?Xo7n?Xqco 󝱻YC7dV#-[oꮤn*Tϳ쮟I$~繗b k/?kUQʶlff^ޤ~=zfhPMI2U 'Ӻ.-8K~s=;ْ~qn[_-?+ha:kI$II](c=Ol_[+ٿY]n/ec]{O[V>?u_Nj,ʮvm{}/Ie WQձ~ޤ:&lOFڪeM$I%7Ń4uds1sqika>Assjo!Z qځf;u hĒI$ş^=}ZF[``v1+̻/S\֜GI}o]mvݿ}VSMDQe*.؏d+З?Ptoe甒I$(Ƴ}f]anCie+OV{:# mm9}?Wm\Xϧ,%1[N_Ev~K~kk$I$9\~pepn5Y=g=?]RŻ<1YuxK,{obU]vgEȎ> =B]B;X܏BWZ?Xzgsl}7P[]fl?о?I$R~W]wm e3éTܼl6; 1]ۍW,L΅Ժk]{=FY=c>ԿjkvZqpelgeҿ*Q$I%=wּOOߌ2kv,lG}{s:my8r)e]TEy=w ʜ@&1>uO>~SZ\^/'ӯgI$S}eȷ㶒@*5VU1~~ڰsmu8Y?&OّgX/}'ni;EWo3WM[e&[gT?Z̷ꭘ3VbI$Jz,VV#nøg^8pO[rgMU披{ _f_ g.WofǴ lǤI$Q$I$IJI$I$RI$I$I$I%)$I$IJYX3 *YX3 *I$JtI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$jm-%Wo1$I%:I$I$JRI$I$I$I$$I$I)I$I$JRI 2.v;li0AϯzI$JLαf;}G`{}6nԫvUe캷UQ"LJmes$I%6[[ZKLr?aUwV+y{v6_?`׎3}CZ^LVޚI$Jm\@81r WsqcE neMSٖ7=uI$Scn7q1Nc\ApD@X4}X P8@@L?7q`ԒI$$>eԟU&w{fYH^ڳ2*4I$IMMncU$ppiu.{:.n.#PEj=/c$I)YٿXnܬu=lVv9c9{/Ki$I)(@ɎSFQxkqc;cҪͿB*G`tћ}trI$Jo$el<*VECnk86c_Q۽uA$I)5 ;en}wR oo1YO˫'}$I)5k + }dcmt!E_rO=sJ]Mѥcxe=6i$I)68ѵS>tWvM-nݻ3}j: 1qY7g7I$IMݺ'N G8TOLIxs+?np6}"w5UoeĒI$dmݺ'ÁәYϾ]cA 'wl&W]ξ]͸l?wI$Sh'Ync9s_Ws4I$Lck$+kIpɎV_n\kƱ{K-9KYk 7X__J~7*=DI$ 5R\oֻ?HcY}: eλvN{^f#k{,=I$SI$I$$I$I)I$I$JRI$I$I$I$,Ϭ?љqiϬ?љq$I%:i$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$jm-%Wo1$I%:I$I$JRI$I$I$I$$I$I)I$I$JRᾶf~稍F;Z~XY>deU4S`]SI$Sg#[jM._Rv#Yse}Xz0Fwog,M_?{Kl`C@{=_nz$I)iӲ2`0* F}V'3NicQzՌ\.@666nK3ծL.`cH^۷$I)羨eQ_b+nWּ:oՋeVޓ5}LxXXϱs=FowGw:5mY8m] [Q[g=$I)ྰngO`oS}UW*:~pxYbmu[Wu{(hk_Rp˾Z=Wve~гf>U?mȷ/ Vjc:S+%.I$SR,)Vޞ=F?,96n0XTu>]ƽθRw Z͵Έ]a,GLJ:]6zA;[r.2~C̏L}_gJRI$S;v^v;2Nec>fm,eƈ}]bwOcWݵT֏ `W\[e}vT@s]?2ĒI$fu)ǽsl-B:L˦ꏬۘ캆f{S)Y}W㜆5ӆKw[+?+t}UfuG^mGCQ$I%"GF8k/~fjucjf=Leo7wbЯn=8Ģ뫥hkXLcSI6;"K`QoX>?Jw1$I%<6 zIxrQ.n{gfacq@mEY۫^!ţcY>#{w?z}v2 m8:[If餒I$#l&uKiVY CD;ҪhPgBKCENhzW?g6KغNNf&sf0YWlTvEomq4$I$[Q]K;h~~='+sױp W5~zi}.?R˗mٜs;hOmI$S1h9.ͪv]~?l\EOiiW>Iv?~v8irC bc]ikG ؙdczlesZluޫ߻!6$I$TçM-m"d1͎'eƛݺayu{O?B+ՕԜ 1cZm>gܰr-[2rk7c}OޒI$}vuw⌬Sm} Ǣ {rbq.6@As4~Fu=;7&gpl[ԇ )erEM%7I$6cepel66W7HQqjkn^pnVn2ʤj)첵/Veu9ߵ8I$}QoCU c|HjeX,x1 zϨYx&1_} -siGOĒI$SJߦE}hꅼ6`Z7UŻEUǤvZe>#t.WFm}a;lc+i$I)I$I$RI$I$I$I%)$I$IJI$I$Rg8sg8sI$4I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$jm-%Wo1$I%:I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)K3f_Zk3f_I$INI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$2Yucuma5:77{?ӭ4I$S7T6*I$INfޯR{?I$I%9zcgKoWolҫM$I$mmU-_ͳJ4I$S7T6*I$INfޯR{?I$I%9zcgKoWolҫM$I$mmU-_ͳJ4I$S7T6*I$INfޯR{?I$I%9zcgKoWolҫM$I$mmU-_ͳJ4I$S7T6*I$INfޯR{?I$I%9zcgKoWolҫM$I$mmU-_ͳJ4I$S7T6*I$INfޯR{?I$I%9zcgKoWolҫM$I$mmU-_ͳJ4I$S7T6*I$INfޯR{?I$I%9zcgKoWolҫM$I$mmU-_ͳJ4I$S7T6*I$INfޯR{?I$I%9zcgKoWolҫM$I$mmU-_ͳJ4I$S7T]ϠV-õ*~lI$I$I$$I$I)I$I$JRI$J=#"V7OĠ]u6ƐO &kNuNAI"!$$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$\ T=RIE ԕ]%c}Z q~cZ !k $WfP۞g^&լh۬}Rk+Qo$N!Xf]od$#+SNI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$HxebJJRI&&5(I-Xᫀ(V$!u]$Р8\KAzͻeU< v-vf5Ȣ֞ OGȷ`yY2@Є&4KZY-KV%βvQC*rI$I$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$Ii $$@Sb%|:hl.V!$ rdu Ӓs]{t\Oe eUD84[,o5W_kAq]HY X›+ HY{ta݊Ne 3U*l|74q:,FKOxu/{k H1_Vs2<֎>k/hW;- O}Q^jAs: BckB序E_ .7Us4vNCm߹g$ԩ&I$I%.I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$vU~vvjԒiPuo%PIm^}^MblBxJDʻ+35r F> ]X!@!ĸAJ~S%:<΋v+VmxXw>)q':HC1jVQ XWqj1P#kKlI\;hmwKuw"?6Oz!h)wII' =r{mOqJfD4ITM.~LkXfJ;̸ed\}DL[jszErK?]i&6< p+ew1GӪh<aA}2\S؈e$roTTI$I$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I->ݒCʖ&JXwI5ܮ S6jy*5M@D#MFV֞Bt,*6y+I׺a=`dZ YXa !d4~ɬ6艂2 ǂKn| I 'P[Zتnh) ]%YE}m%:DѴĨ]/: EO3ՒxϺu{G< @L<j Vewn1 xrV>EcݎA^[7Sݯ }㛻}!Ak_?:sep-ݧw8xwA$e5/4[CՑY![Jxt!zN.iY#݃uu "&I%:} IKi˺NE-J]%tRI$IJI$I$RI2I$J]$I$IJI$I$RI2I'k h -1IK)PI(H IK$Ef-h֓>KW ǒ@t 5X1DZ]=*`5Ec l~fnqM;q-Ĺ1Η++m`۔'<[~x\)Y@ǦSe;@"x:◨܃ah<.^v-U}\lA&94M+bu &g$|ȟʿÃIkgLɬa]jRe!ݡ2|d5< u:Va梻^Ypخ[;[eڴO1-dZ!\cøTI$W2I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I;Z^aIRZ %u]aK&HPqŗ1KCZQJalUԬ͚ɔ l.nXZ'˅ DHA)=Gd8ƝЅ$מPr髸MڄBۋ[ ep)ANQ[gtG"[#kY\#ZyUeQc G&t A*4ENʹn XVqwio*5gwtQIjTHA 9:[Hke}6Y1_ kඋckRPv[oJmƇDQi 4<AV(59`ò6~ ppSl \UkpTpt15ؖ %u#:@G3+"N?5-?@q"|_FxK\}XlwQFqCnbhԍĭ6Pq$Ci3k5qBޣ:7B?"u)Gլy V?՚Y]k*fq/kh+:h}3 >}46#Z5i7`^HOMVe *Ԓ>c⪹ha{)̉。"@d^aJP˵39f-ۀt ba?&#R^juCu7'<GBi c@I3}ԝT ώ$G(y)mSsO$,a>RݭДK W. ekK /'@5FXߕa}cf;Akcvr[3I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$?F]pi,2HVWtd8Y`⺺1p#Nִ6 ԨLL7NꝶLrI>I;pfGu.4IM2{Fbu&Jh<(T gQ4 ȞѢpa@SOB}{EhIWUUh-vZ[ЕVsN\ AM!@8;RЎA MB3DѵfB<̬3=V}ۇsXCAT q./k%Vܧ-)FMmr9R#xϊNJ#dGL:.u=1 r)%HQʞ0fiZ-'@'b3تX X9ULخiIH9 S2,aЬۇ*-2dkZ ;ulUMh#+QIݿnpJ2CP{:['iu t8>8tdsQs6 .7+߻G*G$ w=K-[=w!."6۳$4L2|UWDŽit<z3X @A[iO y\Vp?:pu%>)9xFRSs+oՈO-]* `<s'XU[`N%@D4ԥPr(d"PTi;+5䧂tZ2SIlpBxw1T?Zz5%_e{TJVU&;5Ī[?:mt*mb3<''vMo6$#_fd`xN΃S'E`2_y'@:DLQ&`NTK)){'w A:8P6 HW|Z)Ew2G%`o]!&LI3Z4 Pk 7)H+I䠽>L*/'U!QRP9&FgsREwYۣSS3 Fn3(5ktLʫ~+mikī$h^$Ytjjl 1~Cw .}Z/H5{`nY[u$eݱ tjk8X##q9q)[YŎhI03tI$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$\\g+g%5?!ĸ]HnԠM.mJ.x`x '33}OcN?UX<`v0F"vQʋ#:ǐ?Wst!5:tW{T@ '6ȸ {!kD(v;^4MBSYM" O#U\E#]cDh:8S#A?טz^Ѵ@'y&c[h-apVq. Minfn@CboUMgBmy v!f5+y !{ꕞ[*v:>Yʡ MkXT~Or qCDeYiV@SZw4IAq Z;ۧ*ϖADtyA,[`(G|J9Q6ǒl&sD"Dh)),ܐGL$t:C1(Si&Oc%VLq("@Mb%;N8Sp3Il^=H ]XHP{7 A;)HJK]]M>ԘUϒA?9BÂ;(@n%6~cڋ]5T?5D`YcO8@Q%7tDU?F~)7!6:Q@vVN>Jl?*@{r|tv 6lVx40ݼvOH:L% S`_T}MC,J5Lƀ&&.1RJ J UqL4M[k G nk#:uㄚ x48꒔h-=:[3}GtMl4r~ <'h JJ[s؞~ ͖8HWu:d )@ t|H?$Ē>L^IrI):AxEΊ I*%0kT6`ԝRb/Nw@ @΁D?_%,f gg65=ԝT68H84g1Z]9/sYvځDm-Kaw'C Gmz$+ v`ݰqJY^N豤&!LYðL%+&`()ڡč":i;e$"4P8D :$*b_5wBk66`G*n .ռhBO~ OzA,akx'ĭmpxsLUh흦 :s]^\ Jn5Uty%X7I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I#bY(uT\$ íwr4R QsDꭶoY=K=Z[#]e-"ovNە&&ODn2{)ħKiS4J@(1/;$&;tԀ#ALi"xA L❍Ki|L-Eòdr4΁>ItL:I Ph-kt'?oW* >@OD8D)-:/+pnV+Ѥ@~C!6N@ScDŽVW.%.q$m͛ U>JIwWMYSCR; @H>EN )ФN*F(Z4M3@*QLΩh2U]I w &aBL'hU? A:S< Dw(7h` tOIm.VϷsU{J͍xQn 9(N'D':4L\\mtr$VNĴy8#>hg_JF`nDƜR@*mהNJ#v cu}]6KG)gTRK`&ynRPYwIYfu qeh <j&]IlI Yܤ\x̒ZEb䔜G#RkC"mwd}!bGL)5ѧ ^h-(NΪ;7t)ARRU):%!hUL+6MN U>UqI2; |?ֺ;r?ɑ {k.E}a X=⥉)ޅtkkNicٽtI=2I$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$JUVlpcy&WGs8hHHT%K?,V6{NH+Lny4 &ٶkf:ZϢL>ֹ̪ % 05'caStD<#o5S>)E]e.PR>ϊ##yEL8!>h#EW2hê9"LDRpD7 jj|XHBCYp'Dg8UQ' y-vwY=fm=օw쳝Yem +?Rqu3 z/x65+lRh4R=v(4NZ=Ôę\]: {ܡSϴjAe;\B FZd@P˶nL+dGEOu3TNӍ4IH4= `Bgv Q }rNI$#=G~*OSkL!=>a$p3';\=΅9[@'6{%,$ IB1I[AP]p))-O^ 4 J =OƖ2=4L?8ڒMP]Qi/qx N#yQ:;:)2i$j6 \'@21 6XK!GiDDbdJd^89 4kan(~JDk3e K⒛gju7[F$j1$szwDL瓬@A$O`N! Q |Sn:hpHםgH'}ޛDf>);TK-gRR Rmdx윿lGHYπN \'-I'7RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I4IL Xa + DjVP>*Os&l>E Đ;)9PcBwY;,tA ;B5A蝣s$aQΊc^R: '^Nls&q45) P~  z$$v" iʌa'$˔I$Ny!ǔSbDGc)qV>8yIlգa,[>L8H7cIvd_`&fVRyDGu$Ql*没/)QIT#J0i SЍxDjqtRIx  9 (G _4蜕ȓ)NrOpL[‹[ø*`*=77{|(2I([5մ@e@ TvF7&HuˉѼ>%L;y`וT~Jm ȼ]i~Ww?$b'DHzJl=Гt `Ž]108ىWNy{C'0Xɼ6\Tq^HbANb>i(6{u!KpD(EHDwSrsI$n=KQXO3XN5AĂJfN1jWʭuť`#<$c7I'!I5%DYX)bVhFcX͌+xoU[|E%;uNI$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I-ҝgEc@$EyE%ٖ~WsUaNK1XXa1LsYX{'A&H=8M\{sx27(:<6DvHtDf N4)۹9Hm=Rmq83[dC-۵۴ !`n 'T Hje%'5;]eƀS(9ԫ -=Vj+X]s2KKhTKn䉗[oURmyUY(9673NVFC) T3!@0U[`y,jY%vXlUϻ@Ѡ~ePr;@'V\H$)A h8@ƒ$) Rє :F!qkFL|SZX (3pA9#M Hl;o&5Q5cKNǂ78Z $ȎS`JliR9%h !B2)۪mИAԦn>4: " Lʞlz"R,IIKl9}&$IIvۧCMT蒘PLhtkYADwP B$ tIMvdQ'\O?[lu_xw" 9[vtY2IUq6j$WnM}uW8M-`jMq$M'vKՆ'vSX6Ox粋}:y1::u'_hH0xti@6*np0h'%6*wR'HCen&aqk|ISk<p'KAo/*_\^ma.EyZo%YdeyZS~VGu7Y]Aik'IU4O ]#TT쵮k}A*{L2#qCH4)ʃ_S4IH[٤I#L+28)uNosL CvqZ8nʣas$iI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$4xJRct▐"x&`,0tו hɠ{:!; o{Y&{A GB$>&{DO}I-"1D8eZpk$xv^]2us0[%sK$h3EDGKF%7Pd|WaOG=1\5X4 {g@fB@"Qk%!A›AӺ>=<ZVلC kX粬Z)d[G%Wa6EYMmBsI@2se_caYcL뢎;]2Q$@;nۻ)N1[e%=ʋ䥻lwQ4IwKhTTޤ!wPq< s⣼; Cu\T$[Ӳ=hpӲ>); Tq-!W I!-Dcw{ih>X0Z4D'))uJkG#[D|5Bu"F#ⱬYmlpV0[Ou=!@>Nx"%i}ӟ9HPI,>*mp[AZe%&cUyh!ID"2tDnPṪo!^H1Qot̤Td0 d(E"ڜpBNTt,7_x<'ݖ bL c"}|Po-i` N"9Hue]!Y_S0TI5E?N]?!wtx2AX_L67aX `?ޚAa q8Y\7gLksy.R8H K>nTBWo4Z=%xRgȢ$ N yX'sKI9rTI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I{.1[I$$bNh䝵4෺]ݐL[bW]@4y!k;熉&Yz;\o0<qH f5L|4[ւ[6K;ߴyFv&ȻId ` 1rx0}F0 К veCs6Ĩjg0FP],$PÕ&;H)#^TA(lݐn]h@=T4*uTYY aSYF#C<_kCnCKv[L1Sp:׺)uzFQV#h2gVip#c¶= n~)\4o]Esf?5pճC Ү<(cj*K7LsWIalX0hD=͒Ý.3#|ӵ$꒝}̨lPAUzp\`h0ޢGrpvA,l{ #I"g3 sUv'Oo$rTv(E(xҍ?E$4ƈyẀ"c;AӰ& C!3!ݓZ㹲BA*%nI ;DIT9L T7..I+폂'&0s>)5Hvz'_ʑJb;a(' Sk[`wD(<;Z'"%5 {9J2.*,, xBfDlB`&ЄWH%kJ$BJf]HUѨEhx(4'P?zb`a) ߕM5םSA#]TK[=S=Hq '%-2 ܅Z9$x$X%%':I8ha5JtLONNG? nT5vန"аYTuk<ǂwXOPLBA {DOt}6w_=B{jtvB<Ӈ'UT ;tG~TƶmqF<|kp$&C7sGE&J` LuSu4(d"m%%) ')Sχ4#iskpOQ08AL΂$:|w9)n1"@cTqy'ư ĂRǃV'W#=?\FEǰ`4*A ͿV=xĬoW{;e Ai2z6h{n:\IBINI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$k_XGeX`V~z$$9!TIj7[V*k B8vI!uf0x4Q_J{b3(q$[ *GBwPq Gu h%utv}#ׄhy ֜PZJ̳9I!AddmΙB΁F)\LMv̨Y_@<<[:I8NpleOtO)@nѩRh jS ] rOe(RKD{@ԠI:xQ$kw@3"\Ʃ4%ӴHn9|/n8Ep]aH%-TЯ\Z՘Xx@tOd:.e\eMXײZ'^ 1$$7LAIarj [ y-fgL+u8p纃Z9ILۢHNXI. UޝF{4':(vZtZ6L*62I#lVpKw{IUBpMnNӣI5X[b- ʦi q3*.ImSkA &a R-DMfD$TM}'3Dp68PI6riK h9<*vmhߑ wpn i{uIL7vj۽G4Rq@HO4 ΀hٯ:dasPo%A )vF1(N$%njTDB"{RtVUvv L#ot >44ZWrYKG@&Gܡo`>hcq58L#Xǘ.w#W6ҭ{$W9G@QSˀ$XP{*VՌ #A{Cy#p4(C>))@07쯑jF7٫}(hCHh| OSm?~j$O`Z=P=IPBwޜIEt$0ծ״ d09:ET\N!D`Ltĝ%A (<;'ׅ ftS8iaqsF#_43anJE'.q{($;yAJmBjHqkОa I"NO)D$h!8۰8Qp-tj>PP)v;~Jg2Ho< >SD@Glm=;xOF%8X  y;HC;]O'@_)Rj$Ʃ);jaoQ` 'RdI-D)׼]LC$%Bs/ӳL-ô'48#F@2ɘH4N%jf@;x>ch >TKy'h'SE#?rb䒒kv`8: ^GhQo3@X#]tHáB{*5^lGaN R$nJ%4 )-i ^9!D'O= \D$d1q rR2H'BS Z '䥸yLFt҄L Ni<89a`':|لy7H5 זH5?Dj|T2xv kpRV{[)t'p0S!#q\ ݹVR:N 8p[8) /[fHV?M!ڏ% 4II$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$Ӯ?x} 骩7keK%>5(Ἠ[v;]W=iߥvlt(-UֳIS`$&,4UqCsƒ3Y#g@2sRJIP]c9Mc;j6+GXHIwd+2xQ )d<;)I f}#q2:$[DVR "5 ה|JdL*7QnF:ZsK:徘SCv:7-J%'ޤջiD.0tn⒊3Fv ðRu(gI&9'!MD$\I]^ߊbKJbƙ`kqDw%)i koH)%`S<&3RKTD68Ly$,wڡwy !ſGUi-T)=ξgiSeD7&SgSUZA&hCaIBX `ӕ&*kKdӄ0 Ry> Lx QS˾$*|L$w$DqHH-u2W&> yLc[h1q vD{5Ge@O%: '(it|'XN&=ԁRRĔ܍ ML v05ӄ Κ4@i#SG!Ѡ@*9"F+%*n;yZJ%1wM1Su)Ƕ*@n M i.8R:(tF4BݠOnp "Uru5l,PHk4FU\f=Hԕh8?HN :BgH5ILK@3(o5StjР@v/0R@2BýXA5 -MgSW~7m pGevp"B6l^  $Ч/`_Vsy=;;ݨ*$FE ,"k쉲9IinL8ʕNIUn{$8Nt)$ARJj-GN! ?~SϚ^6ߑaS6h=ಘwi浛 $I$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I.8w]e~#mQq.2;kF9[}x8Y@XvXჺQ!f4Qc!ם{Z^+;ksk`#of`?6Q/nzt(8`ѺǁQ`iYУ#T7},%)8Ɂ)iL`d$SO!7Iϊ&6s t )p`wi &1ɐ]gPI<=nKth GtcR:MuBp B5 {2;'ۻ}'N2Ԕ@=k%πSwD\DNRĸV`HV8Ƕ=y-U/{ 6 ^ ! h Ӆ`:+?Z=:!t;EeU} E`BÙ=ε~hkp*Xj<҂>()4-9_ h1C{Hg粁x )#' /iDU*ߴCu.|U{[J|(m`$IM;ˈ1!}"M#8}EII pR ,ɼ%<3H= e ;"!#Og(:y'M-b %{zQ27H:="xS~AHp ;Zd*eT[fci)KNdpkF'Q*d,j$GiR;c?sV-t( vD& (zuRasvZ}D ܖe [@O!p$h40ln K,J$֏f@T?6}) kP+-?vw $x1pu q[t'*/k;Rmn%5"J&Dbn1 Bw`u Mƙt"?u&Zn;FڅT nka v5h'TX@hB:x$]@wJX Q 33Y'lSS nۧؒ`J[a|6S>C[Y-in Bs4HXD4#o~R4h $q[>Q=oD 1:\FN0dwII3Icf>ʕmd;ToB$^:|-6#/y8\S{k~NLT{W]p";$HtйjV'2tēqC'& hnnӈF5'p\;&aݧr OSJ{A<!IDNTNX>~]H[PaDs[DJ6DLu۫*;'Ӹ| zr"<Ԇj IHf4!> xUngsYs}?;e}h#N$Vf.8-.~,A+"IHI$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I 8ĄLnO,[[mM!NIq-in\KAs Kh?4F7Q 'TB XHBw^`.3›Lt㺋]&\u(-`əӲNi'S•h )mT@:uEhїA͏hUv&k#I&%Eֆ(+U> ii 6}0Ff9y_?kI{4&mz"FCS |yV{ x̯.N`}C<(Es`mEk۵p;GL!3KHr c6SV=nBp3(M[u6#E7I `F=B8ʞ͢eE Q:c%f'ptP:ꝏJ#ķTiL|SLC);1n&P;rPJ4 s=L@Q%%IC)8 a^ .u'醝%g04+8D[$wklX\ti/;uS:kw ZtIIu d Ǧ k=ΰ[߲Et)Z ;b ,E- @v*!.V 5ljIf89DA6^ 2?h)->!" %BflSHԦLRR=>h$'bAUq !Uf3cyOOe:ƐAЭl87oE[/p^ Uݑ'IA%4#JԐݳ.Zcl<@ VZ̹' @ħw0Y6ĩ1OG8hsu+X๺BK uU/;\#%kq?Œ5V\CN1qTK@$W,͑F*>1u v?YN#D1I XEXOyI$ȤI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$]9WH֑^]AaӢ Qvaך f݂z@ü+seBl5ӸA.ʷն;& PKwqq马2O)n7qSR]@J֝H<T5ę~hEa P)&Jx>I)j7=p)Xgn$434U $ѳRӫ6TA JgdyB{\~*N=qا>JuNRJ=f;fL:!k:ԡ ?0-,*LAMm=5x$Ho4Q#KAoiw m$:( NᬣH`Ik0xuRQ`Em!02{߻SUNnGd熹kc*Xn hD6PSZm8<[vGIMO~Q@JgxwV+p yDI!V09Ri`Iid3i3 2dsw,l4Δ;A|k"E5,o%KyQ4kf$&7VSE`!%&qq j`s 3\W!ΠXɋc&JGc%3ݧ1\IcGH6M햝w)orʄ=ѤrJS,i:C !C9cdz;Jg3] v*[]ۼq&cQ1aS> G`ITD8 );=ϒg;i C ѪZRD0cBQb#NL.w:J`Z]tdwQc ³UeO l 9ahyW}D7k~svEx!oc܌}ިv?W(22ΏT:c4a%+},ށjyڕ;F)4<(vDq' I6 ){"e*-"#8(m۝)"I$I$$I$I)I$I$JRI$9CCOk+t5QխN;*;@W$#C²%043Y$5 y 7OtN[bI ,t{e p擠æ Mh0)JMl Vy0[ߔR ;D)jSD p)'f.iiCp(5Hǒ-X| yA[EO2%aB@P~;UN8Kly ).4B{=|_;ҫDHv5V:*i\5IN%7 {+p:]'pi wR@*>wIaKΝBH1a*Mw5IJG%,NXDF)@HϊDH;iGP$' c۸sKIZFJF-iJ@IЦj%b |TI@5PS$hy$N\ .-$I $@R0$7ŰɆkȲrtQ)suݒJIJMgN?rRG3?ܑrIYtRTw)~A@KITT'Bۄmu*{mjRlyIE`[hfTv$_'tT^&LN^;czF:sS>{'$hSn)%$1SuR8IU!#!֍P.)$0pb=>jYJ#G2(Ikd$Zǀ_%Ǖa΀4%E4R(hUNxVQ LuG{K8:+ UMP#2 DB" Nt_\J><G\Z6O3qҵn@䴒I$$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$S6aeu^yw/m^>ݖ'G+Çe]YJsx*Bl٨ λG54M^iM-0[-v߽[7 qt;YV!%#l[UlmCYl uMu*H҈DBX6I)Ssdfe CuNM;&Jw}!8xIL.sM;c^7Ayij't7.Rp3%046i$ Lqc gI(4uTMD"%I<(y%4ËFCƛQ3w3>sS4VnG@ODŏ3cď~yh}-/4MZZxw&`URCZ !b<|TIo; kicOx4i瀩Tt L-2C 2%; ~I<}su۫_2>:i果:` T&Js%B%#nS67NerYXJ j{ ӕ*6;"XBq]hFKq&L!']&T`R`1L5f̥j^pdU{3D{MyecA34TRMhqpE% M6ub WӜ= 2fUUndu!¨>n2ƽ) %Kljmi.q?k KI{\nZyO껣%Ň򮞲$'ZuU5K ̵Z!t`~|&@/ 5mk8Cp0\)H|Rm>:DtK\CT]߉ReGpߦ0` 8H Mt{" L+G. xI$I$$I$I)I$I$JRI$S<;7hp%pav>;Bdس_,l ARcT,c|_yR QSus&{ HLO)~!Wm{(JDQ (m‚| ]ۑi!W8ܥJ8 v/%pyI5J[LAHQg⒉UMk 8=ACq&{qDi -bs '% ԕ&ISq0Gt0ƴ88Ud7駊h %eEI.~{'ݸb<Ճǂuq)CO fBC@'s߄J`S{ ! p(; ; 5.--Acv7o&á;$h(#{$_"S5%!s8 ĸNY<GM f!ER6NIOx4̧4N)ˤE:}" hcۮ!j92t$W4Ъ#@S8zcm su*bʪ}$KۣVdh$6a+MdZحPI'.I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$Hklטw^dV2`&ɒ \$NOn\} S{VZ4Ui Yknʋ0&{&׹3;h| |$ JIw;S-ӂ]&̙DtDomg%+FPRhkLwND'yClyW7@E Es O"Ӵ0X%"2ǔ+Z~drWĆA v*TN) ϒVsy(9]0W9uT,kG'_VEMe#B֧A-*5_: .܇pkُ"GϹ8V iΨ^ gRyא`@H&Aq 0\t<U2Zata<E9[+ >NF\{-yS-+QCѧd!5Am;{gKpUY|)KvT*k.$?rmW&s|XuIjg*HU}Rj,hi,y 8~_Z-q5ùL*̮? vGCz^xHH,/_~B3K'.vp {ƯgHc?S+[i&nW>:3@=3 _`=ÇӺBq]oSV)pޘvs^T"*-l*'u&a%n~Km~ĩ?XTP.<o<4DeD%MtPp(0|N *+ =.1xUkA C Tqfz.2~w0cX.VU@M]:vE5=f=?51R'k i5pH!d :5P6:&{xaCmwlx#QtZC`HDtTη5EnBi{ S9rd]iauG2`꒓Pֱ =ǂ34Bԥ$X>ާUaʳm1yoCĨe事CGnoe*V@>jbM{,奝` Ⲵ$ G3!y{vheg ->KZ'RTC-`p%${O@D)n+)0ϒ悑ji-A(.>&!<}ɠ'.a%,]| @8 [Dt3$)*d߷(485ی(a;X`sFîM q))7{I$I$$I$I)I$I$IƱJRI&&DbX$]++0WE#ml$v۳EYܚ7~Ѧ*Mh=ӂNvJs옵*ar$$"SI>1$A3H̦| ''^ ƊP4L *fL䥷p .0a:Ds0'DͣhprP7 Fӑ.iM%CL.dg!MQ$$d6~\r*m UG:Z> 3*giq|-`%Vw0Unwi.obXK@ *]nݯiQq i-D * J*HIDa(`"ZsǵSƖ1I2eZʴàAs#y-''9 EI 7qikmv4N10e3$,wK @HHB$ja0|IP$ "T{)b: H;|TIhI NJ<$SN.[yoPny Q4CvRtapVvɄquN-Mčhr]#dP^*<ʳi\))hp{-ea45>%__VhQFu[]IP[⧤HU(n! ܒN-<&ѺJ 3AEoY9-Ƹ[2pIRpܚ#IGxw\5 4B@ϑ=:!) nE$H*Ѹ*BMѧ)4TXLo:/*><)5Ƥה i3Ip\qRSH G$[CyZ&R~)<7M5m'.p D;%crh5w 1ʓ<to)FHG楻pdh!@0d8tP7h hL&fڒRuL wPL΃. :pE@ʍm(塀hB浾㯂9N-,f9%YIp2$'t6"+u07*RS-Ǫ s]ckukƚ)Ɓ )D]w(:#ۆ&٪)ELUI4bhUP )Y1 OhT)> SAH}(I!g 5)((5R]0'l~uQLxi ,ӟ5"HRsZ}/%2x(&]HhTB#SǝTmR9N\߉:qqHOD SI*SZS$Q4`w(,% xm HNtF BniPR-"ZOܩYi.ܴdĐ+ {d G%w: (Xc.iS{$iLNK}g i4wM*`a풹tod4|W+hHw 4F=IΞ)0܆]/ G*uNP ۔q Pފ:gT- ߜ 'UcZ;۪Np%CՍSWd *]A^\D#]D4!Wi + {-mM! FGv;⤒O0ItNn$ceG`6'0:44@i'f`3&\X't q"C{rc JK8Zn$@$]5|>>gݽZIsIwn "7u@='=] gUvtn> 8z;@r~h)9Cs矊i&sIILLƾ(v. F6/kD'sg rdw Gze{H=ãC3ڰ\o Muhcׅ7 Xک?d&ݩ=P4q:^Y+1֓[Wqlw+'>iAS9ĸ$TW0 _p;O Xcb5Q<4i )}s $* ?*&N  L$Lt=!Eci>j@ )J:BJb$6FKo~QBNxiISIKD)5:FM?*@h!N0+\]cq+g^-TENB/# [JS /gfόtž]Y*my]NJ=B?*;I9W']y]&O\|WCC+kGU$NcHI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$K_EF~U?FDdh!d;k *}.45T|NOtZ٩;!*xwemjgNBL2;$H3% BL%GpTW9JKq.Ru LaN擨5M k@h"{!Dߺ-גxECw9@k1 BpPJ5gA:]gdJ*sw%@lA:5u.-Ӕ5O4Pߑ_d͸ =&6jQN!tn:(d[-In>@Rǻy EU$H$)N CyQl"?׺vG*ղHLKSWp]3NSTٌZI''QB4죎^74K6`O!i6)m|;ɹkPBx@ׅ?XDvQ%1ǰpײ40230άAL̩vM8IGLƱ GtAa:}(o1WC($O KyT&$㓠Cwi"W 7HY*yI>)-o8RcUl0H Dv.tRSv\ ʻSv ?ry78L$(AÁʘi#Q-.hSɄT5Epe5Ij|R2h |Rd#/>A3 j$$o-c +3"8&a>1R KLy p=MpIe8o(rKlsp 3LwC wA=Սk1)m>h O(CiMp `AǴhZ]V2G)}enq:J;')2'@k@v^7O*HG`)$P%;-fki09J6!RR]Bvs$*_HSmo 3S Gdmy,@#YV-8 T daLѬwIMI1;K"Q =Y$':pX(RS+/8:_3?$ LFɈ@:K`hQHUT.d"5䓸j@r Fv5`װhK|VCkBM\k!yL_qA Wk7%2$!UV;+N-]\lV`*׉\?.{{~⻛DC7 uoҜ -lB0r.S&GA=IYv|U]Ԕ*X঒I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$K`6A+]/նN(KeTgWU|!o`&j%4uRM,fI4@Q&tHHBy eP%3ƅҘe(?wt);MJn<իT9Rlq V$#D' wAJSkW T,6I:€םJI< f"~*gN4 %lj4G: {J 捱ZL S9`#Z}ۉd-%q\m}w x.O$276|LB澽 I$K3UeWp)qkO 2& h9VniͮIs+L*%[Qe>PR%Sn8GGhUq0`I%; 4fvmt4eDP;38@׹A03H3*qEMТ +iAvgZʘ6ʧV;,쇻xh+F$,\ۄp[^=mA :e4qOxKPmn羊BָmHXaF6Iw)OrNk0.jKS0d|6;tǿ6ưwTwTD[!%{cRXДNTn& *:Sumn|-qhDWK.G)phE:. Zlt\c ja CVihJd,Z>jMDzq;G% U&HU1'du IvI&.~i,Gu'UP$q7 %L<,ZxO> [A:LbL"t N!]dqF3&x  ':'$ov*!~%?<%io#̝5B#^\ s :rK(gǴ"n!<DJgs2{Pt8> J'ݪH !0R(n ^܀ײzhͩ=H)4[Pe |T@<Ƥ-$Be+ed$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI&N֗t߫.юOzkF4HǩRGzfXm{{ :Ue0sgڙ֞O^;9kT[&c(8 (&:uCt'jX0J(;tM*5s n0a%χ=qQc%H0 %1Ѣ >%Yphy&` IR 29<ɋ Ӓ:bDϊ! n| v%xޫHP׷G%/gi?+ƚ#A'"a8#R5>5슚3|q>j IruQ45;S)iugH{*3^%, m+v`gu\qm.٬ZRvD {4DRHsࢱgJ3(n~DrSrm8W)@[8$p?zB] H D4"XO*D <9RpfRzZuL(l1 HgZ(f;= p%+SG&{vUk=n-8VnUu{Z5Ԫ4{i_QU QSk/k0t(ڹ { ЏCXe s> Е-"/ *msLx8<=PNt'(Q)3SpU& ˵Vt%di׺2>+omFOeK&sA|ՁNuTMd8vs{N3O$f)?IL*`:! Zky=֍]sdL%p`IK3qo{>+"+dr-0 AOȤTI$I$$I$I)I$K`sOݲ$,) HFPH]U`Tv7o@Gh2ZE=ڧچ\Oy ܩ0R w ܠK80‹g33K{R:'nN("JHP{ijE=`L6 BMD`@RR:BKI;Rn{=IRA1:";&dr~LqH7qP>I;&:9)Iۀd ;a:&N)Fͺ7:;=); 5`:HEcDj̰=klwV5۶9  roEn׺!cuʮ ZkR s& Nbw"{0t b5EXR*fݔlc͎ :J 6۵WSBluV& <ȑ3|R2I)7Ce"<I'63Pqƥ$1q*H*@'D5QX8ySn%4֟G9(92tV#O%{;m䨶!Zd-9+Q 8vpt/VGjE-܆ u!kQ=6 #t ȳo ¹>kdޝvOeeײ` \yT,sdөVFD +ů+rn ZC#T](nIpl'wkysP a2O~`:G-JU\2R Uhðahؖ?S]y̝Jl"1I8?c*N|r6Y$OZc@k !Ucp#gytq`Ј*I%;L w596~i'C\j;,`'Eq=yB/^8C3A!f :s;i*ՒgJ=V}[f[fH/T1X}d\k+j@CqR6BrBs\%B;fUt`DI ߳n\s}Z]q 'T`vA$JKQ=g0" ]qī6m- c4fX\J%R .[I;"Ij,FTZك(L!mS7 Sn'qSAENnNʓTƺ" %F<3EoTo㺤@: QZ4MXF$y(r .O]EiSڦ#R&@I 0:cNXKuP˝dd AWv%I.OϷmR`6m:'No3 ]%y,i- 6O*mPch~gʮ))>%;~ _Cէ[P$8J#4$ih; n IXCth?E)F)<5ܢGNɣpL*M@J,'EO$Bk`&/_&$(59HkF^k߲O4v"@iʕNvSg-I -3T/l`yOLvD4p:L Ryq@+pPn{蝚s(l))HqGTK Qԛ`{vjI!+*)ϛ7@}@MѢ$$pR5ۏ)O39t@ɯapk;a>x%< )LT4R=B}Ƨ4sw> )6+TO=Ӊ0; _}G59kNδND%~ Ԝa9Q$(N`"]6f4>(La t@8 @Ĕ= .k:t[-Ы/tOsG``u;0 Z='4þ `sOc %#DX$ Ml19.ni !5L\>*[=.:9{"ABf1{GL=hֈQ΋NFN O*٠ 25B=K 2my6I [hP;wS*議mGއM~*vnR-%HiΨ{RnJ `|G &s QS\8L`?} TxP=So]aXek*Ir;"8Hx)oJn~3Sv@w Uv㋚\ߤ6'S\%9!5 U6:Oq1,l0 \UGUڈBk=@yYKN:ue Y 頕R.Dˤs-`4:rFSޘ"{$ (5kN8!dQỴx h?rf3 ntM@c]AM:[5?Hd4p~k7uJY[I0_W6>(wZ}ke9fY3 sm˺\c "In0ۧERO%".:zoMƨ` jldLƨn%st\v?p15 ͕Z9LQsg'Fwo$M"xB%) dD p@:%"Ħ`"|$G sCLnc @Fa& )t)yP(!I߂`;];)4TZ{xܔ(7B?MjƊ%.*F{+~j>Y89VƉ˔-~詳}*}8{YjyGŤG`}0{y|L0e6t*3U0y^qmf;aEtXV&As@EDX9Aa粸I$I$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$JJtdIR*;)ED(d,hw%#; F{^k E0 h4Dy J LgiLIBuP`KR#{H S4n%ۻ$kd%&t)<)lk[Q P:;D$B$&aG)qtI;SP-<IIEwn ۬{5*/&}FƠ( )8HQ WEWY" Nk)%Q-tQy PC,E|0y Xa[_\WnvP7Vl*=֮~9-Y0j|};\אUUh{S&,%cdZ'ga^n"t :4h?9܍yqi%5<(R]cfy#E}6׺Z)_v(:hQ\Xj@ ڐ%E<+!-%E UG KFQZ,aN[$vsXQ ͷcnC%J<9js>H6L$ ]{) JAhἱׄ ybIG<_8G `CBӄWp>IF'DDV5%wm(3@y3( Be%QjM *O #lBNJv`T dʅNe Kh!A Nt'aׄWZ渃“ ĕ G1H0+_=T7c|N$DI$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$IJz $&N٫oaQ5 BC[rYn6x,w-r/i4vRnΥB+hf+ݸMR;tlcVK }ֈʱYJ*U\ j:芛ow3}GXCٵ5WDbQ`'^<71]@UͦF˕eEHF-GXk&(%ñROj hW.v<* q:S5ki?(<7)FQCC5hN4<<ڡK]w#QdmMݽI"e@BkI.uzF'qUUx;Z}~QRdSE%"1lh-;ʣSKx2kgB Sq kU]eIHוgi -?Be ̈́@GlǷ(>))#I.@y09B2χ@f*;vO|Jgc?% jķ@cDAVJSY.<'v7u&;"o X u䔃]ѷipLs3 S jl]E3`W7q$ҙ=.(i(dT}"v5Sݕ\UV>0?DwILlڅkXPeuot7Vs)p %jbb9").㪢A#ւ +4#u8([X}5ZkK'9NO 4Ӕ:JY 7L4{FLdj iVUw 6i1*vO+4YSʻ[H<'P>Iz˟-0'[oOkdAȶdI0I굢;'47M4n#E^8n%c ĎuQ$NLMHMc}{|QFV{vӢ̄`x$R dƢuE]]΁[mLh!3gn.B$jLCAQ.ߚd o~kC~eJLRkt.8Z9`(2[߫Y8Dyh@'DYTx$lۇj! kjꇓ`c+C:HhjI%9of QX^H*1-I(hk (HLdLh;9 DQxr'|=TŮЪ'ϳԱ4#4z=6I$I$$I$I)I$JIn얅M^ l^`)(%u.VY9*&j?Rd! ǀQ !)$Ab['}O>0g 3h)&#fc@):>)94옰0{yOED))A)w ׂc8O1*V;;%rD[pēOʈn:DGg2S'I"&QR'ۈ5!q< `(4 %,Rol B |UZ]*l&BE9kA ]'p.2klv Kg^Ɉ~ %Wm6N@|P`y{L"mODڤlLQ75 8;4.sDd=0K40Q_i[:jRMT7Ds[;Ρ'=>h $slne&1$eD)n*IP/%ĕ=%$/M A Aݓw[cBpu-@BpS8Шn(pFm u uImDNN7N}rAlq0 _tjd= *ߩj贆LjLj W),%z`V.DZ VrJ̘ Bw+$u*y.|.TOΗIVF']G̢l%E h)I$>KG;(8Mi~vloCqiG,mZ8XBsƼ"u|M*km -% ?񦜨\OҺLT*t=NL~I'XIx7uJ}LG<( U1Y.hT ,w:"`}m~δ{) 00ܤD蒘ﳒAJ< JMtj#^ӨRӠIK<*hkwUk64:#CR TѼ$Nx 8rw٣AKNLeGs:ƥ;\ A%>5Mc\G&>H5n|];'H(X)%oP4I07%Rk|kpR1:pX%2Pͣu{ {H(Cp5C$'sܤ_&95A0{%Y }3٘RTKPٰ˵E'7]4P29Ii粆QBoYSdjx(P0s]ARC{CDEM6gcy;!nD]{΄pb(*^tM DJ@\d.qW[u!lS~J%i)=PAHO5& hq&t@lQIGetRSX0Nӱ) l0Oh暰&Ku"'Np<$^J*[xgԟ+w甫{\K\4MwCwRhmtRhHԤɀg;su,%΁H%;\Q1 Y4Pu%YsĺcZgy)-o2 $LELP'#D*䵤 ~*u`5NΉ);Hw^g_SAsnJ&w ܂g3g)UciH'4| MѨ*sCABs L>9ɍJ J:‰IKChk| x|A a' 5Ч'Dk0i&$RsG eÀ T"4i7p yh<uO" <ƥI»o Cy@o`䉅1е| HDB D88%b;tT |V].؍%HR%)* Oed۪uI-<0w4p3FMr,a fSe#۩8DDy#H'NGdPV-Rm3Y]?<4p +F0JnGl SM$Ȳ\==a.@;Qii_셒zf?Rft,aI$TI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$[Ȭs]e0 $ԅۑT.n*{ʻ^QyoaPZ_}f;Tv2RɲBVrwmF tp4lIB饅A;IwIDh I$TL%Dv3~z)]0l晰|Q=8PJ(}dTۦ{'y-b2܍f#vfQD„ƎS` <6LJ8K9"2GtA%C菊(BJAxko`c|3: 7qpARV#7 l.X!Kk`ez =XGuw__@5Q{O *tt*k#_ aܩєh:Ρ%0%l|$=H L0HRMH<Ԁ撘:9R!'4nCspOs B \9y -|;ȈE9:(Ljq"uځK%4u+xE&J`ďIHPLڣXTiZݯ5rGAIM<I{jI$I$$I$I)I$Kco4XGJn@lTQT-%v5QfehKv7?gT~ɹ#ws Mϊ\G3FYQ%H){RcAДF:TP{ @}5^;{&h Ԅ.LII0hD蒔hU6Kw<5R#@Fq&{(a%0I'TF|TZTCu* n-RR.wR!G6Ӹa0d G N-vRS2蓪wfE&=%D vS@P3F4<-׏$JwN#nliI6׶A-W+JѯfNhUΪՌ "9Isv>rӲǽφWCqġP.3΁D"5 NQ%P:$dH| wJ%&6$vQ.܊m= 'ACR 4qjSo!$wx`' H4ǒAHÞ$bb [ZkTAP/yHxk\Koc\fF9QsYq"dg :,k w48<~woK=M԰[}d8+Ƶcw#D=薺ruAki^'SncWT6#GL<FZe Z`zַ<*mcIӰ] /݌ؑE7P8BvQpoa>!۝_Q2GuK/`>xdTKJ[CTƍbm i(#nsV eIp&V#w%S롢5΅fL t}*JISk[p5UmĸcAT,pn֐jnJ;nT&*[}'Mv쫺k)Qq-5o:$) MJe||edX\SѸZF#4A)gZ9#'TƉ@&O`O Cc Cue꒘XA'jbl:yxI#-\jaPgS@IMR"c1Hu'9'D@G Ge"t%D  'K "Pv> :D<ΥGtpu>}=甒4hL)' !XMBc@P*+i0UL!\swWs;HtSNB@L4~GJ6T\;IJu&~ Jַ^.u%$Zw E'h zSi##Wݻ.橫@E*7[SQg$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$1ֻ /Kn(ۼ( p6IL yaO qDAuRkH-ڤ8% f4Ĕ^ТhBk* e%3d0AC/ ;"XtNAKrSIK4ÅBfdƉX/{$L}RRKA#4i!G }MQD8ALm%͍gu#[Ax)<]R\N'IL'U;y=I5PF IMKZ s"3uVK>aOeVӹyl꾼qִ g i8k'k\H"IP?HR$~in&`Tˌ(U,KDxQkKAH쥘lxWZ'5Su8]jk'F<éG~N5D =k~21蒙S0ӯuc > {cg|C`NqI&e۠AIISb; YUayLq'NҞBEࣺ()}f1*{e0ioDNGv! {M$$l :ʙ^d>jp]i9JI$I$$I$I)I$KS e5{*CZ`:vA`p8*&q1 n:AE"a"OU8%M &8;$ïܠ6ĉSq^w>#35Q'h3Dw)qA ɖD01rbeDJJ]tTI Lf<KGAE/% <& |0F:5B㔐#)@`8p#폚rH #I)Rh# hUNŮ㲘{cf)G:*'q?Yܟ4:ZZN#;$kR/#lJ=B]=#ll4C!Y6bF`蒩ί /"`$V=%^ h % ,'2ON o"tE(MMQZ@*LڸhKD&ʓ3@i\ `%(+k5JZIRmrRkZ>(y( 0H@'h5; 疴hOW6 lZB's N"7i{<+GM-o !tTKd!Z[h:ޜ8S)W%$6Hԅ-Gjiy*Ħ{v ;i7;@hoQo+5 $ѻ@0yNӦ*G?>էպ.}|uKGt(-bIK/!ݸSk]d•cA%DxIDFx2Hqs@y7>H/))H }#ҡ cװG.Widv = 5))h9IIDis }A"TfS:O60K('lD(c4 )A@ ˋ~:|e%/#w*-hvO_c{̤\~ q=JG:$ SvSc'ī%'UYoqwh4{oȫ5iV H:RGkgm5I;4SiƈmtqvD ]pL@ DEutiJI5LLԕWX N"%O<SW]@5-I2>eZs$G#_di;2~Et&i(Z9ԩNTi ;+|T c-t/{ZUhKhN[ gC$>t@sy%0`c@sCoiĠ=<$Pu%7'([vTj. l1J+  NhgIM{ޣcӰWlUH VMF;h;ƄߒjIt|Tkh㒘Oo&T Jd'(><%I6G~Jy-}J|FDzFBJEc* ǒ# LA?۩D1 IIu@ RkDIRmliܪkh#_<tC>)wnp8<2ռ3A`';"9('N|S;ZaLjq[@=qRB΅@LBIHZ oJX։i0'2DgÐI:J]S9*H\@;)1_sLưu//Қ&[oܐL?B(@kΊ@5% lKL5L 7O!D3$息gu O;F"c+=hLAݳ0Qt1l<&i29ZLܤI@<z!!0w|PĤ x7c}2Q٫D@8qLOܒȏ$7 g&ID)D)lwCudM$,1TDͯ`xS/#PPC]JbƩ1⟙> )84g N)6I$pKPN|]$E93)A1yL\yUlxAoPvrO)) ; lJ.M@DmA(@w$I|RR|:E`c^ 49I$I$$I$I)I$Ka x ]?ժnI%H"@GU<-G) :FTM5@"H)n'XIDSh2: rv6n֏՟4t!8bTLID۷R5J;Ҵ Qq.4t<& ꙢxB#+ S0V[qa=9y׹5XxLQO"e4YcȐFv;hNo=iN JUl/2Uj B=s<-I6HI<plRJ*LBmb&ivB&aH8D9*Ճ'C䧒@Rc Z4)Sn'$D n h.3 =@wQ5v#^S#DTwIALćkJDOh~*^ N qILt \VpDJ%{5 q%!wIHXs;'o$HQs\u& AhY-o!ѽG)i$Nƀ65:}o@iΟ3AIKVif̪Ydj^@upi¬{+ۺEM k w =mMݵ^c&Gs\>hn pA.Jc7P xaA&u*u 4H!eHi%ǰM{2hH0'5:$ }eOiQ2&5RKn |Φ~H)v3 .&x'ku$u ̟3F`A؁<9w-x:k,0N5tNA.Ӆ"F)w$BDj4VbtP'hD&G!%(.'q:xQ%&Fm~ |T SF)A@w@qo(s>|SXC)|R) QcH #\`FuLH HKh;O$ݣR^ZFI*Bwtmn*B= m3-J fH499|NɋNɄ@Cq` ?*h$Zxlӄ*4Ymu֒A!5IOƽ/['ݻH6BSy% )R 81C|{: DHuyEL[$ !|:{H8hRdOtGw i&tILHbcgpM DSxj7!8꒔{& :| $F-.4-HC&yS5;r$(f*5`w7Z.qo)h LRk[33#DCOܘpIЙIK~H~J>杌h4DBq3 <jXF(w@I ?rLnNx䩲6K 1=nǖֻ~KOE8BZ[UI$٤I$I)I$I$JRI$I%>I$I$$I$I)I$K\*~n\>6lU*`VP2Gt;7BVגqqD!ZeBj#o MxpQXv NMIkqED/k9M}"}Ph#s2U7fJHlAEEY3Q@Ǻ〜M%)HSreJlCZ5 '䝧q#Đ] ctd G$TIrv? ?G dwB#0 +Al_x'Y+-}w@vwTI!Ɛ`wW+ <R]y1 kNFÈ[CH!&u/ݵPD`d m'Dڧ4MrNwd=|iQ4MQRRnR5?D+R5Q[=CGe u%L 򫇴>!;!Oos t NݒM,qk*;@O_ɘAΐ}쇐b.p㪳7w']#Sis(X Q7 IrZݩV VD"lhF,jw4@4@!BΤoa-bSF.2Xp׀%"{,W?6yVL9Qs$iuN[>ڎ# SN^ RxڒfXqCZ5c4(5 TFBw䒕}yJ|c2?-VT1Ow8R.CqI Ǥ tZT0]` >d)BwjZS;I9N&ԧ.Eu! {*_t ?dꝮ";$]Ԑ^g6OIJ 6;~ D9t"G:$ I?؛p%$ƩډA> @=:[ww0S#4S53:^DM#v7d1hR =*.qDZ@~ s)BI!`H<[@L%I93 mx)@o -%I]#⥎C"xI>(Er gO|#+\9r?Y:|,}sMwNrh݁Opu #YY]贒I$\I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I%{;!p**t?ӱ ;&+VdT-aFY-i !^ήLv ~1wf{I&"Q===| #W=kݔ˻̕tSJF@kIO0!i4R?DPc␙EH^G*{Ün`)i B;[NR TZD:w˔tIS{>)0Z@vEh.@4|1wuZPl#@ i~ 3v+O%˶IK cw*۬ jNcˏ%hk#Q‰dz/2TJJ XD̄@pnupIKtr YKgщ:(9㓧IDx*5NNѪAy("5Sc䤥t{9RuE\~Bg7nl-1ʃS:l/pcӘz @&$| 6ВKO̤5:~*n .pLʛT k$$UmC&95F`ؐ)RאA )/,y% 6U8pBU 𬽠h )خkwV+ ǰ:ngCJL#)$b6sN"uhp;R{ |RC=Kh3Vs\ њ{(LG@43]u"47qwɬD*Eh9)^yjJMh'Wޭ )[yythinݮC)5PaZAf 3v\ݳ 6|8C|k\UWZxP55+'sel2N'2~јK~4 sQ%0d{hA p5kF/ *2@V @Uk:U[votH3t'8 S/`GeoGP;&7F؀u '*emv..N *BݾqBiNHωHB`/l u-wncOI'1I$I$RI$I$II%>I$I$$I$I)I$JG>CII cPcw44֖z7QTwo+IBjN4KNwD"TZ mn S"" J@p+^SI<$Io) SN@jS ˒E%FK$ & ruJ]2m$D(Kh>i|7ĤzI+ ߡx*LnDuUy)14BTK rP0Nƾ*.a#T`fJg)JMK[HJv:h[jU&Z_OcDH 99Uc\.Į{P^d<"OtwDk&I<$&mA وr~R!D⣦52{p<)T9͞P_6h=+Zv oN54VCI F1TvM7P.CDi7-ӡPIYHI+Ϟ9JH`@(7}AO$@Nݑ'{Ĩ8RII ]n8Qpǔx WgD4WZt &Mgio+2=Z&p*$JgNPs5X=V" ꋌ9ZZ<3, BU*:Ap 8EIZƼRJSFmy H:!Gd1n|{BoH- #`5&I *C2O`EO!/͖]RJbDܪLv{cB S{D1)AkrITMR,!7A20JwhuPHS*OYAaX?i DNKÀ]!z )ͺȚɉU۟!:~C&KAHJJLrCΐY w'ÄV8 DA4F8))i AgAg#Ck5 S{䥸5q3I ;X?Kda Eĉ"w*M$'D`Jw;$#dFΜ|Sx)8uLRS!h$uL J4=ӹiLZL Jh5yp"|KgE?9*GkƲ8?%Ǹ;-D+on]=j\ -!*଼YU7(hst(a[{~-$$y䀒~qGuPpq}gRtVkwUҬ4w))k`#h2- Y llD;!&))aێ զ=e6+=:w0d@Ӹv^t:2tXIOѮU$Lg{h 'Gs CȮ#6KϨ6 7$dǂ%KpO)B*cS oʳGж >*e@ r|T^0 Otiy!!Nm4:@<@@R uT{OOtIK9$I'`$HM5E-3S  a6OܝTI!Z> >*: r9Ih5 %n&TZF&JPTFL&dJPp&;y)>j2v1ܩGE޾ܷG&oe$I |RMm +kςI'1I$I$RI$I$II%>I$I$$I$I)I$I$JRI$R; Jl<5u I0$-*ӅjU'MYShC-%pSeE0L{Ѕ1JΉ 3*OdqKaBJ%)CƩÈr`J`Lu4btLLEՃHE^ND *e5CIӄ`%IIGxJzƼy=m:8N+٢Id\G{ԇMo}QJUˤS))>M[Lp!#4Qw{Y"tQ 5ǔqQd),;G {biNX7$N-`7o=ݬP5Ql;JSp\;$f cu'u< o*`NЫT`K$>#Yxi3XZIB&)"@D{۵Iyv+1x"Tp.X@:z{daE4 ;RfQ [hI?DN>䜳f$ 縝8Ii9G/k]B[NTS%3Z3pg؈&3's"8LB hNxBs3l*F #!*:e&m .< C|@'5 nj߂DVpIq*=Hr.%HQpUh5AcJu#d YAx4+.J SK*%=; `!9 9%S [sܭ iv=hl'Ĥ%W|J& )eKv#UuUč#DBx'C`(N_8nD :O )'#;5yԯFh i^rTlQ?K>䆧PpNrc[ NNuH8N\ߢ;rN$Ŭ!L%"HQc, )  83=LR~t3։ԕ;`o47hA>!X@FgeZ7I^FI̸wS}8U#ӭV4 A VNCSPZgN*\8T NE@%-v{<2dWh|P$Xp<{3QkZ2{,lkkfؓ$("hT@Jn18bJ/:*M9YqhNj))(p ;HqpU@x֐H֒uOB}l=$pۋ}J1<6|)i%ѡJw0% A'yH~o xQ4$., D왎 B6x)]B3<Q,Sc 2e{K pO7?"j؇ #hopxP0⬇ h;kG9  DJAHZpPSy8~iI&TptHp#()ruIo uN FJ6۱N S %1qևk&p@\ xM"kIi> )*oDL4~*5I ~(љNGmҊviA1fhOf@1j%U[VqD%.#_/!W '>[0IX.Unwd[ʬ5{VO@*%0ǭ|@| ١6JnU9+t. ǂg~$k@) ĤZ#lj$Z)06sG|ҝⓚHDŽT$&$p$ǵIPs|Ԝdz[@ܤ3"1Zt`85dxMN%&qQS% HvI:GHe$xQs@&):)Fd3bNHh&BHSk1Tħ&D)H1#8 (N $rL4SSN\WZ_4\GW/{x{2B3[~ ;A:5SI$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$~佖C.z)ee@R&dv:+}ZcQ:M;+iQ%0gTr7A$IżI0kLl <7T --ʉtOdN okQa@L\m0xJ5@do ?K@iMj9)Iv ǔ TKʕ11R0I\4&8<Ja MyiǁLNh%!A'hRK6lw蓬GI 9CRLcpd ڈFD)(sWET'h8I _sw4@RBqphlR}EԂUL1r]%VѠYYFXΈ nn*O u^ApiWgk[,$04rPd=֎+YC>hnZ0;0sʭQZqv'GI)}B ik;2ͦ'qNTc'ԣ=! %OL<φ5TlT0P% 9{KD8B!זiZ>*ݴ,hxIuSnOӭ@A Շ_LCSx TPG5Noq?2[dTjQ]%"֒qnƢWXkQZLy"y J e*vK|5J><*7Oh1RIN)#gx*@jt T8N2aAsK`n⇍\5~\*.1@{E2\)%-ݣG̫WC* "@UxT Sn;)TDƩOe'0 S!H LhTI I)!wL!)ɑ-F%<쒖)s'&](R  %c=ԀMƲiHCQ>$j`'Dx 𐑃 4R RJƼteuK;: s⛓ UX-Jy 9h wH8̦\ErO1h<%BcϐN&uNL(k:S#A OhMHr H>qpODmK`iD-.^͖9Wk}?I79ɑ΅oFCHx)${3$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$]ՠ4$iH:g75YEhucxYi@gH~ hh"$pTRwH: seǀdS$bJ)`wpΩTA,LIB9DOp삓 '@4C;UZfALj5$$Au3qJYC{3%b\~r5IRu)?EH%2ԳWxh  "'v +,e%9 s h2U'Oc\G~6Vn=ʎNy% B,\l :7U?LkEL04WI!]J4N#N k7FĻ !ĞBG5Y}4lr䊛7]Ft2ƀK*KF<(N^O% \ L?!R׺JJ\x:y)t=$m0P@4#acO op$F!^9Z1*~ீL?"RӲy!%<@x+KȆ*~0<;Tj+nv4ϒN$$JѸƉNdL`tNLiܥQfTJY聯/s'Ģ? uSA)>@*,:%(;㮣M!-SN )Jp{`Jm4-%'4 Sݷ^)Pw`CyLpNJStv($lt8eu%L{rXy  >{#۹@5@2E3A>2Bi))%Uq.+$vH+uUcCWqaAuAN; psuۢթm*A𘒮uI=,v6nҊ6D J1oN%xrHT@ ()3;\<)Jb;!nۢJDI{`0?I H;6 %&|S'V4$ǒsX$蓜Z4q)M]\>=>*Q}ܦԃh R1 9!pZ!Ci(RBmFR'1?}O:H9cTdj}S#W$%R`8\|Jzͪ\!T6t0 u[cEֺI$+I$I$RI$I$II%>I$I$$I$I)I$I$JRI$9,և@.#X+c!5Q¼ BӵgDj7s`̢951XXIpkL#iMn|^R'MJHdtMuT^Y 9mO:$%"OUm{'r[Ý톉) {AQlt$@2YKDDړZw8Q{yP2 )y`cû)h*r:j@1PkvI H :(y2sA̩̓nlOtq@' Ӕ1/<6y%G%ڝ w%ImcDȁNJJYyLOdGXPͰ}(:)kAU !-8HTHs!I6>OP-I%1sAӄ+Ct2<Cm[S\Y ;pIp:YWKApp=:vCwIsgX聉F"<'< *%T^A$k #\^DkhJJN(dLnF0n]ǂO;N$ /CF*2iEgGiSnB@;H쒙aA*N*.(Khw=w@$"$0xx}D93 F25*i. N@8hD{hB3*1-򃇬WyЪ@]z;:h7^ٟ "%icmQ(s-LH %aQwTF$*Q[x*LW{{' LʃdS@:3>H74WƞAR˰4N.?"=҉cA"U ͮt[^}8cqqD}%TҒqGjb5*+*f(rAU:&\'Q=mx(Z55-*,lϊg^<J>R~)$.Ɔ@ڴ4]n{j+ey Z]XY]J~YO!0H ,ca`{3x;XLNgx$""JtL{jٵێ_L(gU]S{@cU`jMS+LQsѦ;ʐ2':윙Pۮ)8Hˆ|QS-ݓ 02KBL4%@ Q4NL ĵD:슗$`-%.4#?cNF-L 8)Bt$f8 S[HILƈ'R:tT#O$dJ]%DN m4a(QdR͍e)Y۞Qwon^iKHS|A:$oPt^SD'50pIM8tk*c(1N&BNlJHyHI@)r{x'qH85DxI!ATR$@y _$p*eα @$N@))l$@ӹL 6;T5\@Ĕ #W1ɏ1,h4Jv Q$&yI5:Rݧ]e4Oq<\of6p y4;B٠%5ƃMV]:`>@IKo$N*;:[)QCCƝ{-X @,9z閇Wa'g mrQwmqI-Y26#x_Q):y)S! IO "Z`Hiem/a%D 1.Kpk5hPwohfS裏':#V}Ww)ݩL8IL5#)2Laky'C[4n0 4IK8 -||<<#Tw8A#1O204Ԥר'j`Av-M;[:NL9;%%2k@n`9< ^L&qG?ޜ1tIK-&l~i͆yOxԁ#Qy))cYSnv&G"c^UgA;uRUCSjhxj3N_&E\]4U^6:pn]A"^F;k#1!qJw;y )4q⒖_'T;Z,2HU q5  P2p$j"^6iQqOʦvnL43hS %tlv"](SOY.ԫ "! ^x&ݼRSMcACx\x(Nt 'IL SZs618FJ{Yh$= q$Bzx&גTCCDT-5>wOR4kG;DOb:)]L)vIM4L;ZdJaGD$2x@ qݻfQψ㲍M@䢀?4䨑Jc$E@\brJԑ&-Ѫ~R%3"~m I:jO*,מ{̤Otv6o1ʝhIkD;rFxIK3sDאF߉$|xR 2L9~j߯ )sa $ A.Cd zCsWhg:]NU _< WZ75j!f`d8HL:uwan|u%'СT;zzj4G s˕]5(hD")-cUqsU?gY@{ǟ}RrRR|$3)xL7N/%0h.y=њͽTʈ-FR@RC#U[sOܜX !84Q"qM?DRR@dDS$0 AЩŽԔuTp `J4G $c]xNw [IJq JMߦLqCL%>ܧ4nQ8xr*f:|$\~Jag򬟬 #Ā ?[GJ3ݹD IR!y^I$EjI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$ :{ja>p˸cdÛYRCf8JZyN%FqM/vEF(N x Aӷ|JF -k$\4SvPaL'=tLR{DXOYwI+=TXݣs*+B,oR~As-mTd{huUR&#AN64NSa`;V0c,ʮ9VjvW}` 5K-Z8k*C6jU푴x&/Kϲb)Z${$A;1$qNjILR:;H;tN!nkT4* TqAڍQ0LUR5 l !+6̩VH~k=MڞU{FAs\ HGP5iLw7,s ahk t ƁD0*P@vGJmSfsRֆ†h ]1>J |uTͣiE+ 6f:8qY x 8kZ>+O-,ܠHV-,IHΝ$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$k+ƬLj <OC#Oڦp s u+Sw ?kn9E{AQ|pMa3SR yT\d̑] >)ZKBxFْtnw(cwW;]y>lHD$Ii;Il?G$jNcw CDNmS^Hj(8ۡ?rJamc}HrHdo`iB_HR G)%# 9pPcD4O!wHFt@&:!vIMRS IV3> Ď"K%*>*nn)ľ[p= ˟]t'QU-J!8$I*zz GLuƋZͤq#&x-  tM$ylݩ!VĎ렎]"*F#BۇD|KF~ Vr Z JwgMjRl BJZlQwG % , tD 8H#GE͍l4jUy~Uk5&Z9+5 ѣF܄;C1F,5 1&.™#@RhR`'Rs>% t8Jf™bi[Σ+vO W(~0$k= ;77iԞ?`T: SPd%c\IM M$[ h`lJ&;lFhyʵLLH(~?83 ;Sj۰n>0sv:(Tv%1[ '&1)N7 ) 2$A Q{l#H JpgOxS[JQqGN0; 'OH6yL"9H``BwIJt?I|iv ^Lx!%2t>eB% X548&)%(6 |r8$yhXyS:`g$~h5FGn$2KicHGޢ"@EKn~J"s<O+ohZE=auxiU2VI$ZI$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$ X]Aa lbSUO)uHO%LdR`7m"HM]@Føaq!PNqnaG!z}M=`㺈p$e6;t}E"mI,'RRm㪎3 8ho?r]䩹I lX$ml|RGN|>*&ILicH%2@&*54< \Z;s )I M|$AʃZ+$t1hJE9Nv“`M $AS:sQp%*&A?($BOI両IvLp=SklG*!4K@.A1-%# ?t B)N( N$ E#@iSD;X%DwkhR#IM JQvnZZ~I%,~ڽA<[9VVf ~DyJo[t~ETy$#$sFO齰<#ǂ#%fgNw9PNv:O`$B < jSv4V%մ봨O)XZH(hx3 1v >j-!:5x!H r蔄WjT4ԕ @$0& 7Acd 52cn ӿa#S'Cu!w E~RpkݨSsJ^ pTL\V ! .FeՓtShFO}ScdM N }h(V[o"7E?[7yR>CrC'' Ƙ&To:h TB1=K^l{p[Y"O-WCx們:mv<#DGΗK=OG'D-hhVESt8s ?$37hPl$hI:%a ~HN'`N[[JQJ o}beT+lVAa- ۋ *m*EJ {$'?%"\uwO> -XZ;AyLFT|IBsIgMDLԭjjxZrܙԞ.3%HQ*#S a-Rq#Gr%ZR> )Y;4ǒq[$$x(jN5Z֘!I VST]3%{R=nᦒcǚMhHsJd['RTA=I0F)L )&2#$L\Q$y)m`|wvۮ' Ӵ4Dxx:LQS>Mfk>nY>->1F1oPx0b,IH̝$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$i~^ M+;5܆%075a9+ٿH¤uGD)9%Dt@;#AM] 4o.ׄ'=OmLQ>@tw))(RjBњKRO@4$yO&2{sALx$wP{kC|R㔜4%8!+$xMOh!3:˔ $ޢASaXpL^Ѻ~ L `pTZ>2#t%A܁%$ݭPu@TEÚ߹#]C .TqQqIHk vK+:M!lES2Lk 9l)X jpDyJg v0>wډa$f{!;7w:uX:=.ug`սʿ]h}QN{HM&t `t&V/L浠#_5dLJcjb=0A-b;kc;O$; Q{øR {&ffƁ\ݰ% O6fO⬸k@9M\FeaTZ5X (T*4<c QV1H=ǁIăE8 EFJ'eLEh"5h%H'⒙k!"fe 9?Q:AO$IILI%U8 S9WJc@5/b؈SjX{*9ZnQHMl-QLx5$qԫ;ViV\6Oa9OA# vPt m %3#vBfZyDn{?xTm<<)XL)6`R;{L&J,ArgѸFA4LZONG> ULxAL7]❮k~JVG$ kO4Pǒ\~Hg%ҊcXߞwƎ?4BvLkgYA,ڪiNSYxYy~sR3Cq#ma3ʩ%"̩dia \dgeAԭ)l)uR v|ԜNPѶ[2y?zSLjFLD{$0|D ;_h4' $nC :T]⒘ 𫹻I+p4.ItAWNND(TƨZ p햑2P0ѐ J%m/xcRR:lDy֓ت66uv{J۪l5cg qi{5_W:v$0 }б0.2yWOT:8;IFZ ʗ(t$մ$@R6COMp㸨ʃu'~؁%*'AEIN"8ƆF*5̺%mo)9@L L0jG()Os:t:":7T LDR㔔b { D&%<ӏvBO)$ 9 qJQ$ǐN䔴=MĉӄDLH6'^x ?;"'%-ƳMdޤJ+✟<ݯOtT RRODd~ % m4J' SG/kM$esk㹍tzo|OI$+TI$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$>WrJ]}b-U3Aʶd|X'3#*6A |Ϟܧ3R8+\7"c@շ2O%3;:H:tN%:pq$.᮰ᵩH]\R>rI0Q>/JQGhlh} ΊB~8EhLRB7\\M;'Ik#'uj{2NД~rH[ho J4IAw`>99 "uL_#`ܨLS.Ldpi;BI\58c PdeLC 8A-RV}3Pu&tL 4J}E9L8Rѧ*eRᤍSD m jzb>%V/=DK kjhn(l9E9wm lFco~_|Rn$ٻT6Q{`:!(8I=ԫ RH +`lRЏrwHi:fRln$ikmYvD|L̛BBN=$ҵ#]h:W|QWƿZ'tNr lQϏ Nh&gT 5VQ$9G9GA@6Դ0;yPq!7}%I%uRvPdx<$IS!:a撔 O?y't0SmL$rp)$J^葢Qq[t %)UK@ &a' D( wO:2SN%*A>)F08OtŦbSu&"RJiP)G*S#IL(pe83Ί2IR[@JI^B~Ou0P nP&T1#[ID!svS<G I[fJPDhYC) gDBB%,DwH|T11)Oa%(x?)NTF@BK"gIq%3#\+E]+ -˰60 fJOQI)I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I%)$]5 XWh= l 'L,g3,{<J x{]>4P'):kw@G5-\H b@hQ{KqHԼ!N4}ȇe$蒓5p6pQa&9o(zwF}۟ƞe0! Rt;0$\@  #DݸHnIoAuILX# mP&un9'*Pi⣴()w0 @Lֶ%!I0 H`Q;)1ѪJQn :zfIEp$}-?;Ϛ֗T52QhPr{tT[`|j8>k~487SqpgW:U^M3O#tKIfASa|=rc{jSL Q* PhRk#HlBIGtZ:Iuf'JSKNG@M ''v짻|6d<j 6I0{%Oo)iILp@Nt4ʓX&4IMA;HMcxNhl;:XkDzDw DN,{u))R5ɋˆ$nK7w :g4&&0> ӫR:hd' HX4'@V$ P6 4Vݮd]Aip s `~iYK˅~>斝gḚ{WG "c` O*ui<;N qqa\!]7kXFy.2`IN=y2>Rݥ;ᢃB_ 7ǔ4i$ˇ INc̞ɫ?7! ͭ R1vP74y_R 0|jnx)9qӎ&|PZ<$뭬hT-vs6:A$i(qqJsX ĵd_vDUM#Y> 87B|{U~VsOrdO1BLUV;XvS* Ɖ>H) Jo$D-7n DѬ pLj T[>x"ѸFuH<;>nWQK}ΨZ RSN;;^z#ShP4%jI:aJ*DhTFQRapsAPz"8@`i䪘z oI8D XAxgn,]#:_٨uh d}'uHJgEHV.|JIOMZZcX[|$JcZc{dd;P˧$n t]&%X $CPE% R_Mi"\;;CqC}cB )ϙAMف%Aϑ k9-hL9|aڙK< $8S6 nޗ92Gܥ0 %⥩QӔI@ 84$xgPb; )} bСX'6ri#A8%%p )ֻS%EԂ!qX$6:dp PwNIF$hRS kc>|0~iDu;ZnD7Ds@aI<?DGpB֎Idw: ADh̅luAX kKoh<O 2͟tZx)$HRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$l%r&%6[1JL%mV-[ AM ;EH)D5LC&}S47hJOqLw$.֒$>zf<&ݐՂ)^78F M.Gp{=i$wK{0uK74ƀ?x)li2TIP2\I` y`d7l)mh'pxS2b<PxM9IH[XOb @SKyOxI&'<ƷH(Ht!'4puU4†yS`-I,p"A@%NC|P~׈J'㻂Ű{shI.v^}l4ΤTɟY {vCQ2`{c#!{.L7;CBfIK6t;hp]^SV]撒?7큠Ok ׀ j`q4Ȏ k&RPg$Qΐs"cE73HRiE0h$ $YGRkIod0I0l2dמ%URR_7 %fj=JIY\Q>)t:bISdӠ1c_ߴ|KϹeR+Y-ӹT.$89!-΋k$>yUАCv*EYPC;)= L0y*5װ@O܋]rT'oRIN{~^ۀF;:!u4Eh읢9McEq"gERV<Pj.tD^/~whTj> : htܨd)LBdFxQkFs))pO'KwcL@0#Sn)AC ́ĉ' G:(m\''P!;`"ˢ;מRs4 ,|~HLd)i7۬O4ll I<IxHuL['^RR 4L%?`&hN8 m<q)b=  x 8TK@ ]G!03Jf׹Ύ4R-aqt26Ӫqꁻ@O38ײJCe"Kl*8 a.&GѺFkIa:UyR>rø6M +lHݐhiZ P-JmQx#r^Ycp5ӯd@L&FD[}( nV$eWs:Z|4B R0. ?*߲Ntq;J( TvQDD4H3vD .'HB2q,dQiq4h$8La-IL̀\NHX.>Oe2Qܜ$B2}~xq) xH '%.52oM |JD8'i"{nv,-jHgvb3ի5rgp 5iV gwV{$66HZi(Xݸȍ8Z]>*ndlB*v 5(%zOI;H6HΪA%%osJ >a3'@iyX7RR6n{Em h!ޛutVhXp[DO$^KfU11 ˜'X ]G~ #&d8 )8 ^ SF :{(dMA0wbZ5t"=I@ 5IM@c`p4׺($4!vC> LqXP=Cq-Vs;L"]߿RK J?w,MN ZZ]7h'LۃL+,,$ST[:ɱo?_N/kDzĒKkѱ}6[ )THTՈ؈IսH je;  A&yuELj]+{ *~XOO*,-DLBdM$ vxH$$\XH&@)h']4P9JJ'{IeA-Q/#E<` Rs4EL$u'Y#f_h2淀 [c ' RcΦx&5]b;I)EI+$C!H1D0?*Z`߂~5~uO )Oܣ~I`ܛIϐ&S21H䔦"#vuI$I$$I$I)I$I$JRI$>8:Uˮ껤=`-dJl*ObZ PX3 Iha$ۅ D8 a oKJ{l@nCs|H^h$vIj.qLA)c}IE5Q[Zj*Y$h RK owOÄ POu<{JHѱ(*h>;)k Q ])Hn $T - {ܤ ࣹ)2tI@&mwEK<E$5DwS`;(} 6Ĕ!ΒcE IpTNӿx8N)Zp I;3~L' ꣸}$\#`#D&Iі|T+ qpGG<3M "&qHRպtt %rHv2\9զF%.L_ !ߺ$S#J$wHG%ҏXR  LjZyEѴN>]d7ph1Gyʍ4Z I% -*i,J_k@"&`d'ǔi%">)'Jlԅ+[C"S lMkHh']ŕ@y8wPgNQ\'A1ImkCX wSd pjySn\~I" &.At`Z|GIR|FILx#OHk+\^s#BgDFH($@O$p2=+@t[Al,uY&5:Dz_Zx{su%oҕq;3KOv5g;u ţiUw )^+[V5rz{8Jg8^ɛoKwyImj qȣIBghl`3 D;:4@<%lp j׍܄ش '˷sgzN05uԄvGg*yRw2RɠB Phy''Q5$!9:i | :*%G*Էi(%Hȏtu))#/:<:`kj iOQ/>扉US βʧ|*e6@$Ok@D{&q2! u䩹{;uA$Q! v6GSs' m+ZbJS:hSfi%SiF26a$u#TW2tQLk䂐Whl: 'G2JAħ{~A!=Ѣ)S $Z^tV*t`7ZptL>)4gNvT{i:i FvÔb:R#]CgPktz @dJ!t L⟀ILXP>J81KhOH$LjC=CFH֓ :<5D?B\3I(͠Y> m V\@T-s}1OUa))s.㒆[wW  nx"y!95;ݤ@B kavY`!\; ' 1&("w;I+ q!d;nJ mU.>+\Q\Hn= #>nffՊ ֻhW2Iy.l wr=ϒeZH BAMcewxT?0Ӷ>tԱ|Ni[L#IK>+4!I@{2$>[e[;84Yg9F'9AM|{#EgBt@L 9УF\;߹1ELǼDnp@'L.J|N4~)H:p Dk̅&::'.;䘓Nde%, vNX<ӆh~rSyp'B'@?ćA!HZ8* ؏pGp]R%F++%G6uv>%{<Uޘ7vqq{'T$铤I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$x>Xb,-ECKJy*{S &h Q|5Oct$ 2%;x)]--ѽL$HQ 6NpS-N\L%)% qװM!9QJuyvFmjJ^|`$78@$fd h w)'Z NvyQnTIa%XRwpݠ8% 'P&w r_ -+D$IN6TA)a;)-c?KR.!( X5 ♢q$׸W0]. #X\uLpLp:"L &2*o5 K{2@I꒒Gg b4NRp(7VZcF&J>C4PldͮuBJU~R";" ׽MψLTK 7qF!a%OP w't$1:|%" 3%DIl

<Ihi}\aub;;A؅Z?kp}ZDcEKI+̟Kk#6{N{²hE*w:n%}֛% 謗m:餠`Ic3'gM] Q)%Ulmh]Jr6NTAU&$40 hS8PO9NB@tC.;H\7qTb`LL_$HR-Ʃ.\2R~ bBt$D'!1lA% e0%Kq i )LY %CO%SOpx)r`$dtJ'a;MJD& *NjbHIKܖu8" L$t$gIJHy! `蒘[Gm%9ȔKq!GsFJJcOqO;GA!Kiؔe9\ ʖ GHBH+$ (ʮdCH\:Ou=dBmڕOtԅ 5DB\<vg4Dʐ!4F$":NA$O3r$- );jY)@9.|ԝ[}j)xNPԒ*<i$I9zI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I\9%w滺 Ay0 NSo{Db|kfMN'ǔ$4ϢI[xTTΨ: Ą?4{`d|{;Aە#Oj m%"5Đ$}EN3ٶ䵅5vZګ %þC [?F4?bdݒǒy:sQ]˵ntJmIL P))[y)=ςj]3@?L]KpyANp%β1ʞP-3:*.Etn,5@w: IVipvW. u9|T`!N;I*ek`;p08NeIC<{@C %;EAY*X~ׁ⯝xAN_a~lր;u ::ʧcJd9WnTxִhg(`ESRF4()Jl8U8`pHA!5l%"KvmNX%0c[[FJ)n@dy,ps8*rGv4Ƒ 95,5AU{Ʌ `|;qw*E5IP!uSq 5AM]ViB9 jA)DL RRŀdrxRl^5?rRGD$riqF`R'Gz $WR-6^lN]Oeڤc)$LL;6 %$L9)A)R?11;$v%? cé8zRn8#Wzs`dH U]ܦ羵[gck@p[-"  wB,EZ Kt`*UDW5)u:n#h<+V't6{+l!ġ=4AL\fxBy8Fs]J.>Hnn؅ <$LFa7xF "l7;gHJkTMhHj'Ըc3C7wDHe"ɄTƽ}Quv |;l#D-9Թ3&<:$)2|TX2NeJg]JAFL-=-ƃHRx0I@8k>)$`> ELmN J\QikuSoI+@*/J* -Ħ2Ji$`)L)!ƷkGO A%F6N Ѕ&)$6nXIۉSm*6f!s[],y vxVe{-. ;c_<Ƌc3msVI$I$I$RI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$ьe3"Tg*I/!VУB(ēB[(l: |:)anp< 'DK&59*N3 G)N1DgĆ@ %v8R1^jr@$l N3\>wÒ {Zݲ?8S.m.С' $N$j m *.:y&wK(;ND t;}K"gBia1ԤBhHDDTLT Sm\'e.TIyI+rqN؉L{ O*'EL[{a0'u oXk@&']SDM %CaSATH eú '&M $ t B}IKh{<@(:fwIV]{C#^AӠWP;L|S:BnO{+&[ ,H0|k$x\:N82 N=] >L'TC4oRe~A:&dqs[Mώ0e#%%2s,H:w]$Y`t S%3pxp<|ͰbqILGޖ$=$DĀ ,˹}#ki(BD4,xAwu 0wNRqD(#DxPӻo|'J1"*=)4V~NA2Ʋ~={ǧ yzd:L;t))-W}5ʓI!R Kç"TC'hxC$tvnd 7RzI:^`,wWg:dhTUG#\Fo*a `}v4N‘# I)q3sbt'P:{7F 8Qs0tRp{LOOܥt8%1%1/IOw昏Pi4 &>S;T1lt^[w'kg( |8i !;a'T&7HNt3\K$j=ct|)k^9rAkc fH.WkZNd.f7wH)>&A<vHB02!{Jyd1®O)j3 ̤AَKOjSΤk)"AT4j9V$<:!f[VIiG+7h#~ha"+ }Z,p"@* b(nw)uQ⒛IFakO6r2R ksCt|_≐tXx. &8UuMnpt-( ?%'Gt#Xz˄'RxDnw $ tѢp.>ldItD@J`0@D"5V* JJ\Ien2\c 0>O y!SjJӪ(Bp d6T lv$\G C:J}7#](<84 (v>Z(IP0xׂ$ʝy"Sh  ,Ou0<(ƊaD-#)!2ndO-TLNfBxvE"y$bd %F*F8"G9-<qR%0\[!1) qʝu#ͧNtHxLhs0Ug8+r| }˶O\cIN &4[t7kX{4PI$I$I$RI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I.Vj>q5J.:S/ȍj\e6`U pCMw)FMbFml"u%A %$v ΪUѺ4R#䊒@,JG} jO6I5Bޣe[$'p.pw`\=.)KO A OtÕ puIG~ɉ1 _cT`thX%।ة%IL =T?K$,d8EVhC${"8N I!f^u~*Vlyo={Fp= ;@eI'^Sn*dw`@hC ;}3qa"I&s8LD;R-mF߈I+nJwn3qԩa;$~*GDh(XA˶(n 9ʮ #YV!O))ɭj6]=ӹxvfwZv6HU\7Tr6@!$vI#o*ԬG=ՀHJfGgA UiH?~@;$U8Ru)~W 0RQkZߤ~IV@a^}#OHKԝgO&o@:R%S-{j}ʲIӲS9Р'N mZKHEܓtv Il4#ݢ* 3L7Oht65Cq.'kZQFKYO*/s{yv&M`$eXcDN=cS !@8jҢtS" %$H$$?rf%ݓsd'O5v\@ILKIȉ<4|uR͉A?$htN'$|-jbHjIIL@ӼTdDmtLn)N>S[S9v ̟$hJɃbga6r>PB@GtO ~)LOGQ04y'DyLHS S{Ԕ䙃r@$ čΧOdGu&ILt*;d w)Tr9H$hRܞ@<9vTKA'%%MRJ$$);S):D!5U8FTw+)ALID Il JcLA$(@p%4J*StNO'.k@yBciIJnf p:" #@H?aC6a ^v)eg3ߕS7w;*=9ugw QT6ƮD-5PSf$aLH l}PDDqa1%4&%JA ìup|Jϸ yU!3X';uP|Xξjo\G DCG=n&dwU] vvJ(o0g9P豻xD:)F{$&)NrI,  N]#`ϲs[OtR<7@wIJyn# f{'?VqqqǷd~u\9%2kg^)$OpS n b|ttDv?E /2JNE^WpSH*ZyY3`b86%p-z[ *n%Q ~&[Z٩A{e$ -n-|[dtY8cuw;*aࡼtGixINW7R9V)${8:+;ؙLG*zjۼU4 J\2 -+p h[Y7a-ii$NAUˉ>HB1-VT/t-y>*""8L$N{ACN( $CG"7 i{5>IvJpRÕt̤$Q}I ҂tL'$lmQmlCbKuQ a>KotڤOx:LB96>Yw$8N+Ӓ6u!sgVO{=ZN\DO I$+WI$I$RI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I-VCߚ侮H?]n;5*9n5E=kEPc!H5 D$ qwNw^+ແRa3)Zl7y=sLjS@H O^5Bc O%'m"9MS |{$Ǹ?5Gt/)}f<;:T٬(i S{N|4\O \5:$^Ƀ wLj<'{G!"F-\ rt<9&,.ŽkS>J3=O))8 )Dp 'qTá1ۓDOR>p~0fn*N~ DځE٩䧩RԻ^@#1 Õ6RK0I$v|xR'w!*%C:Q"4IHkd x!a4Q,):ql'30R-0ɒbMQUJ++ip aVcI|4{kUjxV r{ 2yYRy+Q-2GEDDSc)#抒0lt 1L$?$՝hYT75jdn2$BkƊջUIGi`“T[RL-dϊg~(jZ49 jPZ)H$* 99> 5Jg1 w(gImJg3<Ѻ]ب65Z x !I3*c&8UyDžXڣ=+qtSsv*bfR(u<{Œ>I$x(Rs3撃 #J%3X?$A8l)KN@Rہ@4';Px#&o2I(πO'IYӯ:!N&sʋxUl*]S;J#vL{G|PZF%p$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$ƻ(n%f-_IA$Vv򌁖&&#n"tUTfJõ:L*iW&Dh8UlIy) ns@JJk'` w&iDk'xS5R8IQ焔:ܑ%Bhh!u)Ȟ<kHDBJY,LH$`S-HxI-w%2 5X5H~lR04)7A:JdcI<4Lև?V8)`mNJ@05%0}DuX㐆G <Mx D6f%%3A)1p vH  ib`'hRR%DGtԃK2k&'%$I%ha=VI)ITy44_ efӠ#^UqI`N4AND%; WB{&qݯ/L!N)au{.vrf }IGtZ3jL{GI%5-ߑ=M/a/{y'ƁBL@L|L;"onHA$˔K^O$TI $Lq&)5%$ > ${Ku di JAgTR7|@odD2tHQ0DpI sv[ɉIRl\T h'o%#%iD}9ĝ"*vἘ ^Ɂ1S`3ܠARd=S"\a|ҡikLөۛ)YB)9KfUXZ{Ov A球]@]͖U ,bIi_e#ϡdDlq"VFu$ ,Q:BJAX/cCZN{?'l U\B%(IMVҭXO0i=(Lwj6RRWT$-ha-8Tzl![CwtP'%&4Q{x}(Q Z\|Rn)T{:0 dÆ;"8nc|VL;*Unvh=jSJUDK*iyt>KyFMLs <]T-tGɷM7a$è:<.4H;,Hԭd𤜨L @h<($5ǂcmSfu**dnr^ Ap^ L"V &Q.!>&xJdO )Ai|Q$LHAJ=3xb|RSS,7jOYl/l6\@dNMoq0At )niLA#Tf2H&hk'Jds}Eyq$:'@-;|1 tN甔N) 1bI%iow;GܢdILcyE-&BMm#Ri N;$AN#RP IM`Z 4*hG܍O c_$ޚA<;DI4Gq'QxpyLQ*S%0=$.p> e9P#)'YM}ͥ{Q}eD:&؀ͮ \䬌f\O~tOalXd$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I-_2Hi]U$z5S av LP'*V2%D%Zta?D$m- BkZih%ڟr8{iRk 9z:Tߺcxחnwi|ܧ.94 1o8 ww8}]AA#$q*Z -+9*S m|1`I<'$jyQy ǚq}S2C@nDd>I5D&5Q uHk;H<2,0ţMo5b8L.@Nn RS'kg %n{'uH$1$=k$ ARp;AtJΩ%#[$ :̧"c(AA 2N%-kh-vG/AAHcI& u$m0@&4NC"D:[DΩL` 쫝NՆ;D|i+Dwg$i(+꓄|J'U^pF yq'EKs|VQ"@ZĝJ$$vQShKO!̤g9dNfF2 S_S ^xP숔 O !t)!( &|Q79C.B8:g4:wIjD]<E do #-i%CBҒfLJ&u !Kpn 7&rFtr)bDNdS7RR 6L" goW4+ϰ`J\*#G]cΉD$ǷS$8?'qKt꛺~N&)JI_bv?*$IKJ~j'ò&I Aא Ӳ{yR Lx\Npu 5M#i@I2p4I*#yHuO$J.D 5y) RpOu!ТLhOyI gBy>J[gW&24F!3襴d˷hfaI5@8q : N4NLk\̦ H ;氖.NaE8N(2CS=TբP!8$B3 (0H@ac'B5I8Q2 ȝyKBHӄ"2Ӆ`)LiIX~(6 W?lDnG !")IJ&RJڏDx.!11ĦxVoXƳ]v+#v\{Mtjq/VZIJnI$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$Wv9X6q)$n,aEZ@]gr3uEZwGsʌ8vo {]T{A#y4k)ă$FL!i$b $JSkhO ƃM;\ R']SN!%1h %$BOKTD-;II1Oe n8胨S:'ƨ8%~ U#%(%Qx%iDqP.kLFT:{$*J+vL JJke>2`| [Z'XW,i;~220AR`0@ ;ݮ #Tgs:"P9EMLxx*մ4)qΣOG#R |Qa7;oԤb ו8"$&\4S $nqHA*mIH)A;1! $(8 K%Cχh VYQ ";q`'ɔPccQ$,-:?6u #"UuK^"ug7Cl$ƑϚ@?'/"4וjjRS2@w5*O,?O}`U36y+ӯF;dGk9YʎQqV$TvˎkӳNm'_'?]抛h ?i$(E!L(H$r?umpMP ʁf/[{()pR6p9S1@HN :$L4Tݣ1f suƊݠAQ$)qQsˌΨ) ƞJHʎ5@bqDԷq)D鬥IEJ-&9Hiw@Ev:AL]䦘%2`ԑn 3N$AP<4=S9I09!?]I<sHk Ѧ>;ʌe%,>Hc>ݿΦt4DL@?U4IK4 $)z@c`*@)ґɀ&8!$0.'H"RsHâAN]#BR H0t5po ԙׄN Srm_s{w.2~'9W +mOi[ $H]$I$IJI$I$RI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I)VA : Jo &, f}oYv# ]Kt2a[uĦ5$JDh-v nh jBNu# {iRgeZ=5Q;%Dh482`xJIɓb6qԨd7kyȏ2N]j;QhN$$p~㧒ݲ;;þxܥi}y}۴eDwdGi$Ǎ!=SՃOtY{Ήjᮄ΍R pIᢍz);`%K\ J\㪕O$ZeAnH4Ɏvoi bSoHShMSyLc\O:𝠁#%|ACIj1 &&PB6u!dFԞ):>hD=Uڠl#sl(]{B!%0;[?F[`tB Y;JadZܧc*ȼD^A:zWV5jU q" kmHh2|^ Dpwt'a~9IlO:f[5ri>$ ǰ6[ YvΡOPy<䒊4:H㺛a<0;@ \|4)B{%N @Qs< Ap|1\5Z[ԇOMv6eENe$N4/"46Uw{aNP0:{[B!<*k%,L*1ʋ{"8HCp )դ'蒍V$?aj~C@ NB|PH}ߖ4L:gpe()y~%$dBRR|D RO RS&‹\@MG*%O~ȥ\H_yd 4<p!6 ~SHa'G)%dHH%KCg> IKj LO8 D% e $r)|SLvI@)D%g?D̄ U0LZ BAEh@JE3RtJQI%%2hh8L M/% ;GPaBt'wCsA17M2Y%%3BVy:j =6i‰a6n#N%; >9ޢ;|Jc^χkd*cO`G<. ʋ#@BJbi;8b?qHI蓌o% ѧp fuDsOޛv<:N>MhS2{mǒ^{ >[ $)3=uL)i3))w `BgPm OaʇKDDx#TNSy"νSO)yNAസkV-mʝ-  t1%SH3KH`Fk^O2KxJ$0(!ӧ%=l;OTuaR}I<"cV"vM\t!1i'G0k=U609Xv<)p$ƽ,0uVr& %:!yӰ xh@ kϤA$+ S6I!VK%2NTh\= 0z-,p3h70Hrovx)oTDQ[{K#[Jf]sCUT}da;N 4Ӯ.SJcs$Y`l2.>h $hB#jsHm%;na5[T!{--;`xШ${)On|)퓯ۮM 6Ψ)T\4%sC5MΉ<88ww85=TKL:%Tsm-<#8裸y}P0 iRRg?6ݬwDsA; ;>j&%HHKwN`$$hDLv$0'vT1̨ȉxhI+7KݪbH$ 4&>9O0NhB^E$2|m$mp>HN hRl$$tSS-y5;{w4yWsY򧅓OC|BXM:ǂaAI$cdI$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I'qsU t|Nk{eZ1Yeu*6ZnEQ66Z3cÇt k}AQ1ѫCXx {Gd ^wx!=@DHSs AiNIIFHpwU^Y$/sdABk~)60yמ!% Npd;Ď h imp%D;Q=C0KϒaysA$ӵ'HJpỼ&$RxkژC,vBs{8T%2D: gKeТNkg6t q&.$Bh'U< J]-n  pn,8lAl87t w(D:r hCB7F?;Ai*@Ψu˽}v(E &G}RP4C9J[%1!NHO*mQ 3& F0jwh& Ot"& dwQM0tL Y;Mt!;:(·T$,Ol3%rZ/Jtwf5X@*Jha>+ $R6 $I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KOW0F-qit졑C,IG`4̧c+㮁;%cDg 3@s%=[&>G^T]S6y>J`hqfI)twpȓR{5I|V\N!}M"SY$yFvT0AE '6tx#O!ܩOJ_|V]߹I.-֖p>(FIOjO Q" ) 䒘(CJ\x1|0h4qJ=n))|)dʖ͚R[D|p;N!yAhF.\ Obwt򒙵'|l:I#H8#<v$O!%,F%: KX)!Y&uVi@.&*qRR~wKF0\xUwkOKfpk}ӬN]0r&18v~HWkɘc@&%I$IJa%8=ݫ Go(X8=7J ($⒖qVNC[ Gdt rSAE ?l!<A)6ˤ e;Ai 8I,\D}v1>Cʋ+Dv(% Ri55midME;XNIS@<'iNRpi >IDrdoND Q{|NƁ vSɒ7*߫1m3W0Z÷x'RR73h!LXbvƉ첺s+!mQXRG`B|f:uO0 s܅Zw@:MPO ƒߴ"l0q%>QOAil)G%F$gTbQ$jV6wBUݚwR>cOÔDL TDh09#Bܐh&׶شmn